classes ::: media,
children :::
branches ::: transcripts

Instances, Classes, See Also, Object in Names
Definitions, . Quotes . - . Chapters .


object:transcripts
class:media

https://www.jordanbpeterson.com/transcripts/


questions, comments, suggestions/feedback, take-down requests, contribute, etc
contact me @ integralyogin@gmail.com or via the comments below
or join the integral discord server (chatrooms)
if the page you visited was empty, it may be noted and I will try to fill it out. cheers



--- OBJECT INSTANCES [8]


BS_1_-_Introduction_to_the_Idea_of_God
BS_2_-_Genesis_1__Chaos_+_Order
JRE_1169_-_Elon_Musk
JRE_1216_-_Sir_Roger_Penrose
JRE_1236_-_Jack_Dorsey
JRE_334_-_Dr._Amit_Goswami
JRE_550_-_Rupert_Sheldrake
Trapped_in_a_Dream

--- PRIMARY CLASS


media

--- SEE ALSO


--- SIMILAR TITLES [1]


transcripts
select ::: Being, God, injunctions, media, place, powers, subjects,
favorite ::: cwsa, everyday, grade, mcw, memcards (table), project, project 0001, Savitri, the Temple of Sages, three js, whiteboard,
temp ::: consecration, experiments, knowledge, meditation, psychometrics, remember, responsibility, temp, the Bad, the God object, the Good, the most important, the Ring, the source of inspirations, the Stack, the Tarot, the Word, top priority, whiteboard,

--- DICTIONARIES (in Dictionaries, in Quotes, in Chapters)


transcription ::: n. --> The act or process of transcribing, or copying; as, corruptions creep into books by repeated transcriptions.
A copy; a transcript.
An arrangement of a composition for some other instrument or voice than that for which it was originally written, as the translating of a song, a vocal or instrumental quartet, or even an orchestral work, into a piece for the piano; an adaptation; an arrangement; -- a name applied by modern composers for the piano to a

transcriptive ::: a. --> Done as from a copy; having the style or appearance of a transcription.

transcript ::: n. --> That which has been transcribed; a writing or composition consisting of the same words as the original; a written copy.
A copy of any kind; an imitation.
A written version of what was said orally; as, a transcript of a trial.

transcription ::: n. --> The act or process of transcribing, or copying; as, corruptions creep into books by repeated transcriptions.
A copy; a transcript.
An arrangement of a composition for some other instrument or voice than that for which it was originally written, as the translating of a song, a vocal or instrumental quartet, or even an orchestral work, into a piece for the piano; an adaptation; an arrangement; -- a name applied by modern composers for the piano to a

transcriptive ::: a. --> Done as from a copy; having the style or appearance of a transcription.

transcript ::: n. --> That which has been transcribed; a writing or composition consisting of the same words as the original; a written copy.
A copy of any kind; an imitation.
A written version of what was said orally; as, a transcript of a trial.

transcription factors ::: A general term applied to proteins that regulate transcription, including basal transcription factors that interact with the RNA polymerase to initiate transcription, as well as those that bind elsewhere to stimulate or repress transcription.

transcriptional activator proteins ::: Proteins that bind DNA and activate the transcription of DNA.

Transcription Systems

Transcription Systems


--- QUOTES [2 / 2 - 137 / 137] (in Dictionaries, in Quotes, in Chapters)



KEYS (10k)

   1 The Mother
   1 Sri Aurobindo

NEW FULL DB (2.4M)

   4 Ta Nehisi Coates
   4 Bob Woodward
   4 Anonymous
   4 Andr Aciman
   3 Robert M Sapolsky
   3 David Levithan
   2 Tim Dorsey
   2 Siddhartha Mukherjee
   2 Samuel Johnson
   2 Rick Riordan
   2 Ralph Waldo Emerson
   2 Neal Stephenson
   2 Julie James
   2 Joseph E LeDoux
   2 Jean Maximillien De La Croix de Lafayette
   2 Henry David Thoreau
   2 Dale Carnegie

1:Inspiration is always a very uncertain thing; it comes when it chooses, stops suddenly before it has finished its work, refuses to descend when it is called. This is a well-known affliction, perhaps of all artists, but certainly of poets. There are some who can command it at will; those who, I think, are more full of an abundant poetic energy than careful for perfection; others who oblige it to come whenever they put pen to paper but with these the inspiration is either not of a high order or quite unequal in its levels. Again there are some who try to give it a habit of coming by always writing at the same time; Virgil with his nine lines first written, then perfected every morning, Milton with his fifty epic lines a day, are said to have succeeded in regularising their inspiration. It is, I suppose, the same principle which makes Gurus in India prescribe for their disciples a meditation at the same fixed hour every day. It succeeds partially of course, for some entirely, but not for everybody. For myself, when the inspiration did not come with a rush or in a stream,-for then there is no difficulty,-I had only one way, to allow a certain kind of incubation in which a large form of the thing to be done threw itself on the mind and then wait for the white heat in which the entire transcription could rapidly take place. But I think each poet has his own way of working and finds his own issue out of inspiration's incertitudes. ~ Sri Aurobindo, The Future Poetry Inspiration and Effort - I,
2:[The Gods and Their Worlds] [...] According to traditions and occult schools, all these zones of realities, these planes of realities have got different names; they have been classified in a different way, but there is an essential analogy, and if you go back far enough into the traditions, you see only the words changing according to the country and the language. Even now, the experiences of Western occultists and those of Eastern occultists offer great similarities. All who set out on the discovery of these invisible worlds and make a report of what they saw, give a very similar description, whether they be from here or there; they use different words, but the experience is very similar and the handling of forces is the same. This knowledge of the occult worlds is based on the existence of subtle bodies and of subtle worlds corresponding to those bodies. They are what the psychological method calls "states of consciousness", but these states of consciousness really correspond to worlds. The occult procedure consists then in being aware of these various inner states of being or subtle bodies and in becoming sufficiently a master of them so as to be able to go out of them successively, one after another. There is indeed a whole scale of subtleties, increasing or decreasing according to the direction in which you go, and the occult procedure consists in going out of a denser body into a subtler body and so on again, up to the most ethereal regions. You go, by successive exteriorisations, into bodies or worlds more and more subtle. It is somewhat as if every time you passed into another dimension. The fourth dimension of the physicists is nothing but the scientific transcription of an occult knowledge. To give another image, one can say that the physical body is at the centre - it is the most material, the densest and also the smallest - and the inner bodies, more subtle, overflow more and more the central physical body; they pass through it, extending themselves farther and farther, like water evaporating from a porous vase and forming a kind of steam all around. And the greater the subtlety, the more the extension tends to unite with that of the universe: one ends by universalising oneself. And it is altogether a concrete process which gives an objective experience of invisible worlds and even enables one to act in these worlds. There are, then, only a very small number of people in the West who know that these gods are not merely subjective and imaginary - more or less wildly imaginary - but that they correspond to a universal truth. All these regions, all these domains are filled with beings who exist, each in its own domain, and if you are awake and conscious on a particular plane - for instance, if on going out of a more material body you awake on some higher plane, you have the same relation with the things and people of that plane as you had with the things and people of the material world. That is to say, there exists an entirely objective relation that has nothing to do with the idea you may have of these things. Naturally, the resemblance is greater and greater as you approach the physical world, the material world, and there even comes a time when the one region has a direct action upon the other. In any case, in what Sri Aurobindo calls the overmental worlds, you will find a concrete reality absolutely independent of your personal experience; you go back there and again find the same things, with the differences that have occurred during your absence. And you have relations with those beings that are identical with the relations you have with physical beings, with this difference that the relation is more plastic, supple and direct - for example, there is the capacity to change the external form, the visible form, according to the inner state you are in. But you can make an appointment with someone and be at the appointed place and find the same being again, with certain differences that have come about during your absence; it is entirely concrete with results entirely concrete. One must have at least a little of this experience in order to understand these things. Otherwise, those who are convinced that all this is mere human imagination and mental formation, who believe that these gods have such and such a form because men have thought them to be like that, and that they have certain defects and certain qualities because men have thought them to be like that - all those who say that God is made in the image of man and that he exists only in human thought, all these will not understand; to them this will appear absolutely ridiculous, madness. One must have lived a little, touched the subject a little, to know how very concrete the thing is. Naturally, children know a good deal if they have not been spoilt. There are so many children who return every night to the same place and continue to live the life they have begun there. When these faculties are not spoilt with age, you can keep them with you. At a time when I was especially interested in dreams, I could return exactly to a place and continue a work that I had begun: supervise something, for example, set something in order, a work of organisation or of discovery, of exploration. You go until you reach a certain spot, as you would go in life, then you take a rest, then you return and begin again - you begin the work at the place where you left off and you continue it. And you perceive that there are things which are quite independent of you, in the sense that changes of which you are not at all the author, have taken place automatically during your absence. But for this, you must live these experiences yourself, you must see them yourself, live them with sufficient sincerity and spontaneity in order to see that they are independent of any mental formation. For you can do the opposite also, and deepen the study of the action of mental formation upon events. This is very interesting, but it is another domain. And this study makes you very careful, very prudent, because you become aware of how far you can delude yourself. So you must study both, the dream and the occult reality, in order to see what is the essential difference between the two. The one depends upon us; the other exists in itself; entirely independent of the thought that we have of it. When you have worked in that domain, you recognise in fact that once a subject has been studied and something has been learnt mentally, it gives a special colour to the experience; the experience may be quite spontaneous and sincere, but the simple fact that the subject was known and studied lends a particular quality. Whereas if you had learnt nothing about the question, if you knew nothing at all, the transcription would be completely spontaneous and sincere when the experience came; it would be more or less adequate, but it would not be the outcome of a previous mental formation. Naturally, this occult knowledge or this experience is not very frequent in the world, because in those who do not have a developed inner life, there are veritable gaps between the external consciousness and the inmost consciousness; the linking states of being are missing and they have to be constructed. So when people enter there for the first time, they are bewildered, they have the impression they have fallen into the night, into nothingness, into non-being! I had a Danish friend, a painter, who was like that. He wanted me to teach him how to go out of the body; he used to have interesting dreams and thought that it would be worth the trouble to go there consciously. So I made him "go out" - but it was a frightful thing! When he was dreaming, a part of his mind still remained conscious, active, and a kind of link existed between this active part and his external being; then he remembered some of his dreams, but it was a very partial phenomenon. And to go out of one's body means to pass gradually through all the states of being, if one does the thing systematically. Well, already in the subtle physical, one is almost de-individualised, and when one goes farther, there remains nothing, for nothing is formed or individualised. Thus, when people are asked to meditate or told to go within, to enter into themselves, they are in agony - naturally! They have the impression that they are vanishing. And with reason: there is nothing, no consciousness! These things that appear to us quite natural and evident, are, for people who know nothing, wild imagination. If, for example, you transplant these experiences or this knowledge to the West, well, unless you have been frequenting the circles of occultists, they stare at you with open eyes. And when you have turned your back, they hasten to say, "These people are cranks!" Now to come back to the gods and conclude. It must be said that all those beings who have never had an earthly existence - gods or demons, invisible beings and powers - do not possess what the Divine has put into man: the psychic being. And this psychic being gives to man true love, charity, compassion, a deep kindness, which compensate for all his external defects. In the gods there is no fault because they live according to their own nature, spontaneously and without constraint: as gods, it is their manner of being. But if you take a higher point of view, if you have a higher vision, a vision of the whole, you see that they lack certain qualities that are exclusively human. By his capacity of love and self-giving, man can have as much power as the gods and even more, when he is not egoistic, when he has surmounted his egoism. If he fulfils the required condition, man is nearer to the Supreme than the gods are. He can be nearer. He is not so automatically, but he has the power to be so, the potentiality. If human love manifested itself without mixture, it would be all-powerful. Unfortunately, in human love there is as much love of oneself as of the one loved; it is not a love that makes you forget yourself. - 4 November 1958 ~ The Mother, Words Of The Mother III 355
,

*** NEWFULLDB 2.4M ***

1:Ink is the transcript of thought. ~ Alphonse de Lamartine,
2:The brief transcript of moments, written on the body, is so deeply satisfying to read. ~ David Levithan,
3:When someone tells me that 'the Almighty told me to do this', I want to see the transcript. ~ Fred Reed,
4:This brief transcript of moments, written in the body, is so deeply satisfying to read. ~ David Levithan,
5:Literally, I see my writing as transcription - a transcription of what I see, hear, think, live. ~ Hank Azaria,
6:My aim in painting has always been the most exact transcription possible of my most intimate impression of nature. ~ Edward Hopper,
7:In our memories the stories of our lives defy chronology, resist transcription: past ambushes present, and future hurries into history. ~ Anthony Doerr,
8:At the hearings, the presiding senator kindly offered to have these documents inserted into the official transcript once they were found. ~ Kevin M Kruse,
9:As human beings, we are the genetic elite, the sentient, contemplating and innovating sum of countless genetic accidents and transcription errors. ~ Gary Hamel,
10:Many books in popular psychology are a melange of the author's comments, a dollop of research, and stupefyingly dull transcriptions from interviews. ~ Carol Tavris,
11:A lawsuit is to ordinary life what war is to peacetime. In a lawsuit, everybody on the other side is bad. A trial transcript is a discourse in malevolence. ~ Janet Malcolm,
12:Thus transcription factors regulate genes. What regulates transcription factors? The answer devastates the concept of genetic determinism: the environment. ~ Robert M Sapolsky,
13:Newly released transcripts reveal that President Nixon was drunk during the Arab-Israeli crisis of 1973. After hearing this, President Bush said, 'Hey, so was I!' ~ Conan O Brien,
14:It was not a question of knowledge...but of alertness, a fastidious transcription of what could be thought about something, once it swam into the stream of attention. ~ Susan Sontag,
15:I recently read some of the transcripts of Nixon's Watergate tapes, and they spent hours trying to figure out who was leaking and providing information to Carl and myself. ~ Bob Woodward,
16:Writing seems to rob me of my being: it is a second hand mode of communication, a pallid, mechanical transcript of speech, and so always at one remove from my consciousness. ~ Terry Eagleton,
17:Show me a transcript of the words you’ve spoken, typed, or texted in the course of a day, an account of your doings, and a record of your transactions, and I’ll show you your religion. ~ David Dark,
18:This is how memory works: not as a transcription but as an attempt—as an essay is an attempt . . . to locate meaning between the irretrievable then and the equally unfathomable now. ~ Patricia Hampl,
19:When you start thinking about taking pictures, sending an e-mail, receiving an e-mail, speaking into your phone and have it transcript voice into text and then sent as an e-mail, it's mind-boggling. ~ Steve Largent,
20:I did not see any major issues other than the jury substitutions. I can't know whether there's a problem there, until I read the transcript from the in-chambers conference, when those jurors were excused. ~ Catherine Crier,
21:Everyone is a recording to everyone else, a memory, a past transcript embedded in air or water or sound or light. No matter how close they are, they are not here. What they said, when they said it, it is not now. ~ Charles Yu,
22:When you start doing television, you want a transcript of what you're going to say, and every time I've had to do that, I've looked at it and gone, "That's just not funny." It only comes alive when you speak it. ~ John Bishop,
23:Increasing pressure on students to subject themselves to ever more tests, whittling themselves down to rows and rows of tight black integers upon a transcript, all ready to goose-step straight into a computer. ~ Leah Hager Cohen,
24:Man Thinking must not be subdued by his instruments. Books are for the scholar's idle times. When he can read God directly, the hour is too precious to be wasted in other men's transcripts of their readings. ~ Ralph Waldo Emerson,
25:I will raise up prophets to make conflicting pronouncements that inevitably will be garbled in transcription, resulting in mutually exclusive definitions of orthodoxy from which the open-minded will flee in dismay. ~ Sheri S Tepper,
26:There were, like, 20 of [Jackie Kennedy's biographies], which was interesting because they are not exactly high literature - they are pulpy.But the [Arthur] Schlesinger transcripts ended up being the most useful of anything. ~ Natalie Portman,
27:I'll release my tax returns when Barack Obama releases his college transcripts and the copy of his admission records to show whether he got any loans as a foreign student. When he releases that, talk to me about my tax returns. ~ Mike Huckabee,
28:In ten days’ time, the police only managed to set down two pages of legal transcripts. In brief, it was an unpleasant experience. I only think back on it when I piss and I notice the whitish scars that the electrodes left on my dick. ~ Massimo Carlotto,
29:The Boston Transcript once printed this bit of significant doggerel:   Here lies the body of William Jay, Who died maintaining his right of way— He was right, dead right, as he sped along, But he’s just as dead as if he were wrong.   You ~ Dale Carnegie,
30:Alamos. Il a analysé en détail les Transcriptions Extraterrestres.                                        Une réplique de l’OVNI allemand Horten 229 (l’avion de chasse furtif d’Hitler) redessiné et ~ Jean Maximillien De La Croix de Lafayette,
31:Alamos. Il a analysé en détail les Transcriptions Extraterrestres.                         ______________________________ Une réplique de l’OVNI allemand Horten 229 (l’avion de chasse furtif d’Hitler) redessiné et ~ Jean Maximillien De La Croix de Lafayette,
32:The ones that landed near the bathroom are Bad Tolkien imitations or transcripts of a D&D adventure; bad Herbert, Heinlein, and Asimov are below the television; and these on the bed are the ones whose authors I want to hunt down personally and slap. ~ Sharyn McCrumb,
33:What is clear, however, is that the Bible and most other ancient transcripts, scriptures, legends, and mythologies all recognized and testified to a powerful antediluvian race of superhumans reigning as kings and demigods over the mortal and mundane humans. ~ Gary Wayne,
34:All my stories were usually titled, 'White House Says,' 'President Bush Wants,' and I relied on transcripts from the briefings. I relied on press releases that were sent to the press for the purpose of accurately portraying what the White House believed or wanted. ~ Jeff Gannon,
35:Poetry aims for an economy of truth - loose and useless words bust be discarded, and I found that these loose and useless words were not separate from loose and useless thoughts. Poetry was not simply the transcription of notions - beautiful writing rarely is. ~ Ta Nehisi Coates,
36:Innovations created by evolution encourage and enable faster evolution. In the case of the evolution of life-forms, the most notable early example is DNA, which provides a recorded and protected transcription of life’s design from which to launch further experiments ~ Ray Kurzweil,
37:He, who writes an Encomium Neronis, if he does it heartily, is himself but a transcript of Nero in his mind, and would, no doubt, gladly enough see such pranks, as he was famous for, acted again, though he dares not be the actor of them himself.South’sSermons.2. He ~ Samuel Johnson,
38:Protocols of the Elders of Zion, supposedly a transcription of a secret Jewish council’s plans to subvert legitimate governments and take over the world, were sold internationally in the 1920s and 1930s; Henry Ford took the forgery as literally as Adolf Hitler did. ~ Richard Rhodes,
39:Nakalimutan na ng tao ang kabanalan n'ya, na mas marami pa s'yang alam kesa sa nakasulat sa Transcript of Records n'ya, mas marami pa s'yang kayang gawin kesa sa nakalista sa resume n'ya, at mas mataas ang halaga n'ya kesa sa presyong nakasulat sa payslip n'ya tuwing sweldo. ~ Bob Ong,
40:However, the Bible is called the Word of God because the whole transcript is an inspired, faithful, and infallible record of what God determined essential for us to know about Himself, the cosmos in which we live, our spiritual allies and adversaries, and our fellow man. ~ Walter Martin,
41:The philosophical implications of "predictive coding" are deep and strange. The model suggests that our perceptions of the world offer us not a literal transcription of reality but rather a seamless illusion woven from both the data of our senses and the models in our memories. ~ Michael Pollan,
42:I can buy a shotgun any time of day without the slightest background check, but if I need something for my sniffles, it’s six forms of ID and complete school transcripts. The government has essentially created a system where if I want to clear a head cold, the easiest cure is to blow my brains out. ~ Tim Dorsey,
43:And the fact is, I don’t want him looking like an idiot. And I’m not going to sit there and let him look like an idiot. And you publish that transcript, because everything leaks in Washington, and the guys overseas are going to say, I told you he was an idiot. I told you he was a goddamn dumbbell. What ~ Bob Woodward,
44:first a wind ensemble playing a transcription of the Appassionata piano sonata; then Beethoven’s opus 134, which was his own transcription for two pianos of his Grosse Fugue for string quartet, opus 133. Lastly a string quartet was to play a transcription of their own for the Hammerklavier sonata. ~ Kim Stanley Robinson,
45:Before parents accept the wisdeom of a school board to cut school librarians, they should ask: Will my child graduate with a 21st-century resume, or a 19th-century transcript? . . . As the information landscape becomes ever more complex, why does a school district want to abandon its professional guides to it? ~ Mark Moran,
46:Even so, as was his custom, he writes the name in an abbreviated form: “Wllm Shaksp.” It also has a large blot on the end of the surname, probably because of the comparatively low quality of the paper. Though it is only a deposition, it is also the only document in existence containing a transcript of Shakespeare speaking in his own voice. ~ Bill Bryson,
47:blemish,n.

The slight acne scars. The penny-sized, penny-shaped birthmark right above your knee. The dot below your shoulder that must have been from when you had chicken pox in third grade. The scratch on your neck- did I do that?
This brief transcript of moments, written on the body, is so deeply satisfying to read. ~ David Levithan,
48:As I sat there working on transcriptions at my round table in the morning, what I would have settled for was not his friendship, not anything. Just to look up and find him there, suntan lotion, straw hat, red bathing suit, lemonade. To look up and find you there, Oliver. For the day will come soon enough when I'll look up and you'll no longer be there. ~ Andr Aciman,
49:As I sat there working on transcriptions at my round table in the morning, what I would have settled for was not his friendship, not anything. Just to look up and find him there, suntan lotion, straw hat, red bathing suit, lemonade. To look up and find you there, Oliver. For the day will come soon enough when I’ll look up and you’ll no longer be there. ~ Andr Aciman,
50:As I sat there, working on transcriptions at my round table in the morning, what I would have settled for was not his friendship, not anything. Just to look up and find him there, suntan lotion, straw hat, red bathing suit, lemonade. To look up and find you there, Oliver. For the day will come soon enough when I'll look up and you'll no longer be there. ~ Andr Aciman,
51:Biovirus TA TA TA targets organisms, hacking and reprogramming ATGACTTATCCACGGTACATTCAGT cellular DNA to produce more virus virus virus virus virus virus virus virus. Its enzymic cut-and-past recombinant wetware-splicing crosses singularity when retroviral reverse-transcriptase clicks in (enabling ontogenetic DNA-RNA circuitry and endocellular computation). ~ Nick Land,
52:With the release of the transcripts Nixon had allowed America into the ugliness of his mind - as of he wanted the world to participate in the despoliation of the myth of presidential behavior. The transcripts, Garment thought, were an invasion of the public's privacy, of its right not to know. That was the truly impeachable offense: letting everyone see. ~ Bob Woodward,
53:This rhetoric that Donald Trump is used is very consistent with rhetoric he's used on the campaign trail for a long time now. He'll always say - and you look - you can look at the past transcripts of his old speeches. He'll always say, I'm in favor of trade; trade is great, but these deals - NAFTA, TPP, the South Korean Free Trade Agreement - are all terrible. ~ Avik Roy,
54:I was reading a transcript of a talk by Ponlop Rinpoche, and he said, “In the process of uncovering buddha nature, in the process of uncovering our open, unfixated quality of our mind, we have to be willing to get our hands dirty.” In other words, he was saying that we need to be willing to work with our disturbing emotions, the ones that feel entirely dark. ~ Pema Ch dr n,
55:There are still many questions about how law enforcement responded to the shooting at the Pulse nightclub in Orlando.To get some answers, media organizations, including NPR, have asked for tapes of the 911 calls and other recordings. So far, authorities have not released that audio, only edited transcripts. Doing more, they say, would re-victimize the survivors. ~ Audie Cornish,
56:Reading aloud sounds like a good idea, but honestly, it doesn't work very well. Good dialogue in a book doesn't actually bear much resemblance to real-life dialogue. For example, if you've ever seen a word-for-word transcript of people talking, it doesn't read off the page very well. The trick is to make it *seem* like it's being spoken, not to make it speakable. ~ Patrick Rothfuss,
57:So figure it out for yourself. Which would you rather have, an academic, theatrical victory or a person’s good will? You can seldom have both. The Boston Transcript once printed this bit of significant doggerel:   Here lies the body of William Jay, Who died maintaining his right of way— He was right, dead right, as he sped along, But he’s just as dead as if he were wrong. ~ Dale Carnegie,
58:You are not saintly (a good person) because an organization says so, but rather because you stay connected to the divinity of your origination. You are not intelligent because of a transcript; you are intelligence itself, which needs no external confirmation. You are not moral because you obey the laws; you are mortality itself because you are the same as what you came from. ~ Wayne Dyer,
59:I like the idea of the book being wiser than the person who wrote it. None of the novels I've written are direct transcriptions of me blathering over dinner with a glass of wine in my hand. I don't hold any illusion of those conversations being of particular value. The books, though, are - I hope - bigger than my opinions, investigations that go beyond my own intellect or wit. ~ Christopher Bollen,
60:We thought requesting grades and transcripts was a blunt instrument to get at smarts. And it did weed out the disappointing number of people who lied about their records. But in 2010, our analyses revealed that academic performance didn’t predict job performance beyond the first two or three years after college, so we stopped requiring grades and transcripts except from recent graduates. ~ Laszlo Bock,
61:Not sleeping enough, which for a portion of the population is a voluntary choice, significantly modifies your gene transcriptome—that is, the very essence of you, or at least you as defined biologically by your DNA. Neglect sleep, and you are deciding to perform a genetic engineering manipulation on yourself each night, tampering with the nucleic alphabet that spells out your daily health story. ~ Matthew Walker,
62:Make no mistake: I’m all about guns! I just love the legal incongruities our national discourse has spawned, like I can buy a shotgun any time of day without a serious background check, but if I need something for my sniffles, it’s six forms of ID and complete school transcripts. The government has essentially created a system where if I want to clear a head cold, the easiest cure is to blow my brains out. ~ Tim Dorsey,
63:Yet this is not a novel. It is a faithful transcription of my memories, some of them hazy, others riddled with holes left by the passage of the years, others patched up by time and the filters of experience and distance, and still others, no doubt, completely invented by the stubborn narrator we all have within us, who wants things to be the way they sound best to us now, and not the way they were. ~ Alma Guillermoprieto,
64:Unwin was tired, too. He had worn himself down—to nothing, nearly—with his cuts and corrections, his erasures and emendations. He was awake now, but was there still time for him? His mind had wearied of its appointed rounds, of the stream of typescript and transcript, and now he wondered what might have been different, what might still be different, if only the day would hold and not abandon him to sleep. ~ Jedediah Berry,
65:In Washington, as we learned from the White House transcripts, a president may speak of kicking butts, call a problem a can of worms, decide not to be in the position of basically hunkering down, anticipate something hitting the fan, propose to tough it through, sight minefields down the road, see somebody playing hard ball, claim political savvy, and wonder what stroke some of his associates have with others. ~ Edwin Newman,
66:Sleeping in a hallway around Bedford Park later that week, I took out my blank transcripts and filled in the grades I wanted, making neat little columns of A’s. If I could picture it—if I could take out these transcripts and look at them—then it was almost as if the A’s had already happened. Day by day, I was just catching up with what was already real. My future A’s, in my heart, had already occurred. Now I just had to get to them. ~ Liz Murray,
67:She looked for the deposition transcript she had dropped, she turned around and—

—the entire audience in the galley cried out in shock.

Unbeknownst to Payton, when she had fallen her skirt—those damn slim-fit skirts she liked so much—had torn at the seam and now gaped open, and sweet Jesus, she was wearing a thong and two tiny white butt cheeks peeked out from between the folds of her skirt—

J.D.’s jaw nearly hit the floor. ~ Julie James,
68:What I missed most when I lost a man I loved was someone who held a record of my life from that time. It was the way we told each other things. Without them I went back to my quiet life, but with them there was a transcript of living. Transcript, of all words, as a way to describe love. But we all want, in some way, to be able to record our life, and for some reasons lovers do that for each other. Of all things. Of all jobs for them to be given. ~ Sara Majka,
69:For poetry was all written before time was, and whenever we are so finely organized that we can penetrate into that region where the air is music, we hear those primal warblings and attempt to write them down, but we lose ever and anon a word or a verse and substitute something of our own, and thus miswrite the poem. The men of more delicate ear write down these cadences more faithfully, and these transcripts, though imperfect, become the songs of the nations. ~ Ralph Waldo Emerson,
70:What's impossible not to notice, though - it's all around us - is the diminution of American prose: How pedestrian it has become. Pick up any short story and listen to its voice, the tedious easy vernacular that mistakes transcription for realism. This would display an understandable pragmatism if it were a pandering to common-denominator readers; but it is, in fact, a kind of hifalultin literary ideology, the less-is-more Hemingway legacy put through an up-to-the-minute industrial blender. ~ Cynthia Ozick,
71:A more appropriate expansion is the statement "it is the responsibility of intellectuals to speak the truth and expose lies" a transcript of a talk to a writers conference in Australia in 1996, where I had been asked to talk on "writers and intellectual responsibility" - a question that I said I found "puzzling," because I knew of nothing to say about it beyond truisms, though these were perhaps worth affirming because they are "so commonly denied, if not in words, then in consistent practice." ~ Noam Chomsky,
72:It is now widely realized that nearly all the 'classical' problems of molecular biology have either been solved or will be solved in the next decade. The entry of large numbers of American and other biochemists into the field will ensure that all the chemical details of replication and transcription will be elucidated. Because of this, I have long felt that the future of molecular biology lies in the extension of research to other fields of biology, notably development and the nervous system. ~ Sydney Brenner,
73:The other night I searched (the Web) for 'self-transforming elf machines.' There were 36 hits! It surprised me. I sort of use the search engine like an oracle. I've used the phrase for DMT, 'Arabian hyperspace.' So I thought of this, and then I searched it, 'Arabian hyperspace,' in quotes. And it took me right to a transcript of the talk in which I'd said the thing! You can find your own mind on the Internet. I'm very grateful to the people who type up my talks and then post them at their websites. ~ Terence McKenna,
74:The first “Zigzag files” were released to the UK National Archives in 2001. These declassified archives contain more than seventeen hundred pages of documents relating to Chapman’s case: transcripts of interrogations, detailed wireless intercepts, reports, descriptions, diagrams, internal memos, minutes, letters, and photographs. The files are extraordinarily detailed, describing not only events and people but also the minutiae of a spy’s life, his changing moods and feelings, his hopes, fears, and contradictions ~ Ben Macintyre,
75:When a fissure off the California coast started pumping and dumping oil on the nearby towns and beaches, everybody started dumping on Union Oil. Matters weren't helped one iota by a manufactured quotation attributed to Union's president, Fred Hartley, alleging his amazement at the publicity for the loss of a few birds.... Fred Hartley never said what the press reported, as the transcript and the Senate committee members definitely established. But I don't suppose the truth will ever catch up with the more colorful falsehood. ~ Malcolm Forbes,
76:This is heaven.” And I wouldn’t hear him say another word for at least an hour. There was nothing I loved more in life than to sit at my table and pore over my transcriptions while he lay on his belly marking pages he’d pick up every morning from Signora Milani, his translator in B. “Listen to this,” he’d sometimes say, removing his headphones, breaking the oppressive silence of those long sweltering summer mornings. “Just listen to this drivel.” And he’d proceed to read aloud something he couldn’t believe he had written months earlier. ~ Andr Aciman,
77:Poetry aims for an economy of truth--loose and useless words must be discarded, and I found that these loose and useless words were not separate from loose and useless thoughts. Poetry was not simply the transcription of notions--beautiful writing rarely is. I wanted to learn to write, which was ultimately, still, as my mother had taught me, a confrontation with my own innocence, my own rationalizations. Poetry was the processing of my thoughts until the slag of justification fell away and I was left with the cold steel truths of life. ~ Ta Nehisi Coates,
78:WARNING: The following is a transcript of a digital recording. In certain places, the audio quality was poor, so some words and phrases represent the author's best guesses. Where possible, illustrations of important symbols mentioned in the recording have been added. Background noises such as scuffling, hitting, and cursing by the two speakers have not been transcribed The author makes no claims for the authenticity of the recording. It seems impossible that the two young narrators are telling the truth, but you, the reader, must decide for yourself. ~ Rick Riordan,
79:WARNING:
The following is a transcript of a digital recording. In certain places, the audio quality was poor, so some words and phrases represent the author's best guesses. Where possible, illustrations of important symbols mentioned in the recording have been added. Background noises such as scuffling, hitting, and cursing by the two speakers have not been transcribed The author makes no claims for the authenticity of the recording. It seems impossible that the two young narrators are telling the truth, but you, the reader, must decide for yourself. ~ Rick Riordan,
80:GOOSE, n. A bird that supplies quills for writing. These, by some occult process of nature, are penetrated and suffused with various degrees of the bird's intellectual energies and emotional character, so that when inked and drawn mechanically across paper by a person called an "author," there results a very fair and accurate transcript of the fowl's thought and feeling. The difference in geese, as discovered by this ingenious method, is considerable: many are found to have only trivial and insignificant powers, but some are seen to be very great geese indeed. ~ Ambrose Bierce,
81:Now consider a genome consisting of genes A and B, meaning three different transcription profiles—A is transcribed, B is transcribed, A and B are transcribed—requiring three different TFs (assuming you activate only one at a time). Three genes, seven transcription profiles: A, B, C, A + B, A + C, B + C, A + B + C. Seven different TFs. Four genes, fifteen profiles. Five genes, thirty-one profiles.fn7 As the number of genes in a genome increases, the number of possible expression profiles increases exponentially. As does the number of TFs needed to produce those profiles. ~ Robert M Sapolsky,
82:a transcription of a prophecy from an ancient account of Christianity’s earliest saints; the book itself had come from the personal library of one of the university’s eighteenth-century presidents, the Scottish clergyman and theologian, John Witherspoon. Though the sentiments sounded like something from the book of Revelations, the words were attributed to none other than “the Holy Desert Anchorite,” a reference, quite plainly, to Saint Anthony of Egypt. “And there, in the barren soil of sand, home to snakes and scorpions, the seeds of destruction shall be planted and grow. ~ Robert Masello,
83:Matter and energy are equivalent, according to the equation E=mc2, where E stand for energy, m for mass and c for the speed of light,' 'Merapa explained. 'Matter can't be transported at the speed of light but energy can. Therefore, during a time shift transformation, matter is converted to energy then condenses back. In other words all the molecules in your body have been changed from matter to energy then back again.'
'Wow. It's a wonder it's not fatal,' Dirck said.
'Sometimes it is. If any transcription errors occur between the DNA and RNA in your vital organs you're all but dead. ~ Marcha A Fox,
84:Well, looks like we’re going to Penn. College decision done.”

“Well, one of us has the transcript for Penn,” she says slowly, wrinkling her nose at me.

“Ugh. How hard could it be?” I eye the door, hoping for another glimpse of Finn.

Chloe pinches the bridge of her nose. “It’s Ivy League, Everly.”



“So I’ll Legally Blonde myself together.”

“Good plan. You remember how that movie ended, don’t you?”

I nod. “She gets the guy.”

“Not the guy she got into law school for.”

Humph. Sometimes Chloe is just so literal. “It’s an outline, Chloe. We can edit as we go. ~ Jana Aston,
85:Environment? February 06, 2015 BEGIN TRANSCRIPT RUSH: Scott in Hampton, Georgia. I'm glad you called, sir. Welcome to the EIB Network. Hello. CALLER: Hello. It's good to talk to you, Rush. Um, I wanted to make you aware, if you're not already, about an impending environmental disaster. It involves the oceans, and it's being caused by the tendency of the higher-end restaurants to use real sea salt on their tables as seasoning. It's taking too much salt out of the oceans and the result of course is gonna be a decreased salinity of the oceans. That's going to affect the sea life, and I've not heard much about this. RUSH: ~ Anonymous,
86:In the middle to late 1970s, when Putin joined the KGB, the secret police, like all Soviet institutions, was undergoing a phase of extreme bloating. Its growing number of directorates and departments were producing mountains of information that had no clear purpose, application, or meaning. An entire army of men and a few women spent their lives compiling newspaper clippings, transcripts of tapped telephone conversations, reports of people followed and trivia learned, and all of this made its way to the top of the KGB pyramid, and then to the leadership of the Communist Party, largely unprocessed and virtually unanalyzed. ~ Masha Gessen,
87:After the stock market crash, some New York editors suggested that hearings be held: what had really caused the Depression? They were held in Washington. In retrospect, they make the finest comic reading. The leading industrialists and bankers testified. They hadn’t the foggiest notion what had gone bad. You read a transcript of that record today with amazement: that they could be so unaware. This was their business, yet they didn’t understand the operation of the economy. The only good witnesses were the college professors, who enjoyed a bad reputation in those years. No professor was supposed to know anything practical about the economy. ~ Studs Terkel,
88:These experiments showed that there was a region on the X chromosome that was vitally important for X inactivation. This region was dubbed the X Inactivation Centre. In 1991 a group from Hunt Willard’s lab at Stanford University in California showed that the X Inactivation Centre contained a gene that they called Xist, after X-inactive (Xi) specific transcript10. This gene was only expressed from the inactive X chromosome, not from the active one. Because the gene was only expressed from one of the two X chromosomes, this made it an attractive candidate as the controller of X inactivation, where two identical chromosomes behave non-identically. ~ Nessa Carey,
89:I was learning the craft of poetry, which really was an intensive version of what my mother had taught me all those years ago -- the craft of writing as the art of thinking. Poetry aims for an economy of truth -- loose and useless words were not separate from loose and useless thoughts. Poetry was not simply the transcription of notions -- beautiful writing rarely is. I wanted to learn to write, which was ultimately, still, as my mother had taught me, a confrontation with my own innocence, my own rationalizations. Poetry was the processing of my thoughts until the slag of justification fell away and I was left with the cold steel truths of life. ~ Ta Nehisi Coates,
90:The discussion contains strong and previously uncommunicated descriptions of the philosophy behind WikiLeaks and how technology affects power dynamics and social structures. It includes concepts for how to use decentralized technology to protect revolutionary activity—ideas I would love to see taken and implemented. And at the level of symbolism, the discussion sees two different futures of the internet in conversation with each other: the one, a pervasive internet of centralized corporate governance; and the other, a vibrant, decentralized internet, fit for the emancipation of human history and human beings. When Google Met WikiLeaks is the transcript ~ Anonymous,
91:Infectious diseases cause a rise in oxidative stress, which is largely responsible for coordinating our genetic response to the infection. As we age, mitochondrial respiration also causes a rise in oxidative stress, which activates essentially the same genes through a common mechanism that involves transcription factors like NFΚB. Unlike infections, however, ageing is not easily reversed: mitochondrial damage accumulates continuously. The stress response and inflammation therefore persist, and this creates a harsh environment for the expression of ‘normal’ genes. The expression of normal genes in an oxidized environment is the basis of their negative pleiotropic effects in old age ~ Nick Lane,
92:What is that 95 percent? Some is junk—remnants of pseudogenes inactivated by evolution.fn4,3 But buried in that are the keys to the kingdom, the instruction manual for when to transcribe particular genes, the on/off switches for gene transcription. A gene doesn’t “decide” when to be photocopied into RNA, to generate its protein. Instead, before the start of the stretch of DNA coding for that gene is a short stretch called a promoterfn5—the “on” switch. What turns the promoter switch on? Something called a transcription factor (TF) binds to the promoter. This causes the recruitment of enzymes that transcribe the gene into RNA. Meanwhile, other transcription factors deactivate genes. ~ Robert M Sapolsky,
93:You still want to know, don’t you? You’re still curious. I mean, I don’t blame you. Here’s the thing: does it matter exactly what happened and why those girls were excluded? It’s irrelevant. It happened. Done. Over. I’d rather not go into it. We don’t have to reveal everything to each other. That’s another thing I’ve learned in therapy: it’s OK to be private. It’s OK to say no. It’s OK to say, “I’m not going to share that.” So, if you don’t mind, let’s just leave it there. I mean, I appreciate your interest and concern, I really do. But you don’t need to pollute your brain with that stuff. Go and, like, listen to a nice song instead. MY SERENE AND LOVING FAMILY—FILM TRANSCRIPT INTERIOR. ~ Sophie Kinsella,
94:Michael Faraday, the son of a Yorkshire blacksmith, was born in south London in 1791. He was self-educated, leaving school at fourteen to become an apprentice bookbinder. He engineered his own lucky break into the world of professional science after attending a lecture in London by the Cornish scientist Sir Humphry Davy in 1811. Faraday sent the notes he had taken at the lecture to Davy, who was so impressed by Faraday’s diligent transcription that he appointed him his scientific assistant. Faraday went on to become a giant of nineteenth-century science, widely acknowledged to have been one of the greatest experimental physicists of all time. Davy is quoted as saying that Faraday was his greatest scientific discovery. ~ Brian Cox,
95:Those who have not learned to read the ancient classics in the language in which they were written must have a very imperfect knowledge of the history of the human race; for it is remarkable that no transcript of them has ever been made into any modern tongue, unless our civilization itself may be regarded as such a transcript. Homer has never yet been printed in English, nor Aeschylus, nor Virgil even, works as refined, as solidly done, and as beautiful almost as the morning itself; for later writers, say what we will of their genius, have rarely, if ever, equaled the elaborate beauty and finish and the lifelong and heroic literary labors of the ancients. They only talk of forgetting them who never knew them. ~ Henry David Thoreau,
96:Our society is becoming increasingly aliterate, says Cullinan. “An aliterate is a person who knows how to read but who doesn’t choose to read. These are people who glance at the headlines of a newspaper and grab the TV schedule. They do not read books for pleasure, nor do they read extensively for information. An aliterate is not much better off than an illiterate, a person who cannot read at all. Aliterates miss the great novels of the past and present. They also miss probing analyses written about political issues. Most aliterates watch television for their news, but the entire transcript of a television newscast would fill only two columns of the New York Times. Aliterates get only the surface level of the news.”13 ~ Jane M Healy,
97:C’est là une des raisons pour lesquelles l’idée, émise par certains sous prétexte de « commodité », d’écrire l’arabe avec les caractères latins, est tout à fait inacceptable et même absurde (ceci sans préjudice d’autres considérations plus contingentes, comme celle de l’impossibilité d’établir une transcription vraiment exacte, par là même que les lettres arabes n’ont pas toutes leur équivalent dans l’alphabet latin). Les véritables motifs pour lesquels certains orientalistes se font les propagateurs de cette idée sont d’ailleurs tout autres que ceux qu’ils font valoir, et doivent être cherchés dans une intention « antitraditionnelle » en rapport avec des préoccupations d’ordre politique ; mais ceci est une autre histoire… ~ Ren Gu non,
98:In a few dreams, I’d answer the phone and hear a long silence, which I interpreted as my mother’s speechless disdain. Or I heard crackling static, and cried out, “Mom? Dad?” into the receiver, desperate and devastated that I couldn’t hear what they were saying. And other times, I was just reading transcripts of dialogues between the two of them, typed on aging onionskin paper that fell apart in my hands. Occasionally I’d spot my parents in places like the lobby of my apartment building or on the steps of the New York Public Library. My mother seemed disappointed and rushed, as though the dream had pulled her away from an important task. “What happened to your hair?” she asked me in the Starbucks on Lexington Avenue, then she trotted down the hall to the restroom. ~ Ottessa Moshfegh,
99:During a news conference aboard a plane on his way home from Seoul on Monday, Francis was asked: "Do you approve [of] the American bombing?" The question was set up with a comment that the United States is "bombing the terrorists in Iraq, to prevent a genocide, to protect minorities, including Catholics." Francis avoided addressing details of the Iraq conflict, instead going into a more general discussion of Catholic theory and teaching on war. "In these cases where there is an unjust aggression, I can only say this: It is licit to stop the unjust aggressor. I underline the verb: stop. I do not say bomb, make war, I say stop by some means. With what means can they be stopped? These have to be evaluated. To stop the unjust aggressor is licit," he said, according to a transcript by America magazine. ~ Anonymous,
100:At the end of our visit, Fleisher agreed to play something on my piano, a beautiful old 1894 Bechstein concert grand that I had grown up with, my father's piano. Fleisher sat at the piano and carefully, tenderly, stretched each finger in turn, and then, with arms and hands almost flat, he started to play. He played a piano transcription of Bach's "Sheep May Safely Graze," as arranged for piano by Egon Petri. Never in its 112 years, I thought, had this piano been played by such a master-I had the feeling that Fleisher has sized up the piano's character and perhaps its idiosyncrasies within seconds, that he had matched his playing to the instrument, to bring out its greatest potential, its particularity. Fleisher seemed to distill the beauty, drop by drop, like an alchemist, into flowing notes of an almost unbearable beauty-and, after this, there was nothing more to be said. ~ Oliver Sacks,
101:Paphlagon was eerily calm—almost jolly. “If one were to examine a transcript of that, one would see an extraordinary, and quite lengthy, catalog of every rhetorical trick in the Sphenic book. We’ve seen appeals to mob sentiment: ‘no one believes in the HTW any more,’ ‘everyone thinks Protism is crazy.’ We’ve seen appeals to authority: ‘refuted in the Twenty-ninth Century by no less than Saunt So-and-so.’ Efforts to play on our personal insecurity: ‘how can any person of sound mind take this seriously?’ And many other techniques that I have forgotten the names of, as it has been so long since I studied the Sphenics. So. I must begin by applauding the rhetorical mastery that has given the rest of us an opportunity to enjoy this excellent meal and rest our voices. But I would be remiss if I did not point out that Fraa Lodoghir has yet to offer up a single argument, worthy of the name, ~ Neal Stephenson,
102:To look squarely at the suffering of the ordinary people whose misery is recorded in the transcripts makes me feel that I am not qualified even to be called a “survivor.” It is true that I was one of the last people to leave Tiananmen Square on June 4th, but I did nothing to volunteer myself during the bloody terror of the massacre’s aftermath, nothing to show that a kernel of my humanity had survived. After I left the square, I did not go to Beijing Normal University campus to check on the students from my alma mater who presumably had also left the square. Still less did I consider going out into the streets to minister to dead and wounded whom I did not know. Instead I fled to the relative safety of the foreign diplomatic housing compound. It is no wonder that the ordinary people who lived through the butchery might ask: “When great terror engulfed the city of Beijing, where were all those ‘black hands’ ”? Fifteen ~ Xiaobo Liu,
103:I was not in any slave ship. Or perhaps I was, because so much of what I'd felt in Baltimore, the sharp hatred, the immortal wish, and the timeless will, I saw in Hayden's work. And that was what I heard in Malcolm, but never like this - quiet, pure, and unadorned. I was learning the craft of poetry, which really was an intensive version of what my mother had taught me all those years ago - the craft of writing as the art of thinking. Poetry aims for an economy of truth - loose and useless words must be discarded, and I found that these loose and useless words were not separate from loose and useless thoughts. Poetry was not simply the transcription of notions - beautiful writing rarely is, as my mother had taught me, a confrontation with my own innocence, my own rationalizations. Poetry was the processing of my thoughts until the slag of justification fell away and I was left with the cold steel truths of life. ~ Ta Nehisi Coates,
104:And yet it fills me with wonder, that, in almost all countries, the most ancient poets are considered as the best: whether it be that every other kind of knowledge is an acquisition gradually attained, and poetry is a gift conferred at once; or that the first poetry of every nation surprised them as a novelty, and retained the credit by consent which it received by accident at first; or whether, as the province of poetry is to describe Nature and Passion, which are always the same, the first writers took possession of the most striking objects for description, and the most probable occurrences for fiction, and left nothing to those that followed them, but transcription of the same events, and new combinations of the same images. Whatever be the reason, it is commonly observed that the early writers are in possession of nature, and their followers of art: that the first excel in strength and innovation, and the latter in elegance and refinement. ~ Samuel Johnson,
105:For most if not all forms of memory, in most if not all organisms, the protein synthesis process underlying memory storage is triggered by the activation of certain genes within the neurons forming memory. A key activator is the gene transcription factor, cyclic AMP response binding element protein (CREB).32 Extinction learning is no exception because it, too, involves CREB-dependent protein synthesis.33 CREB activity is regulated by neuromodulators, such as norepinephrine and dopamine, that are released by way of CeA outputs. Many other molecules and steps come into play as well.34 The result is that during extinction learning, recently active synapses on those neurons that undergo protein synthesis are strengthened, and new patterns of synaptic connections across the various neurons in the network constitute the memory. Reactivation of those synapses results in retrieval of the extinction memory, which suppresses the original CS-US association. ~ Joseph E LeDoux,
106:Then there is the matter of the presidential untruths. The problem is not just that Barack Obama says things that are untrue but that he lies about what Barack Obama has said. He brags that he set red lines, but then he says it was the U.N. had set red lines. He boasts of pulling out every U.S. soldier from Iraq but then alleges that President Bush, the Iraqis, or Maliki did that. He claims that ISIS are Jayvees but then claims they are serious. But his prevarication too is habitual and was known in 2008 when it was discovered that he had simply misled the nation about his relationships with Jeremiah Wright and Bill Ayers. He had no desire, in the transparent manner of John Kerry, Al Gore, John McCain, or George W. Bush, to release his medical records or college transcripts. If Americans find their president ill-informed, there was no record that he was informed in 2008. His gaffes were far more frequent than those of Sarah Palin, who knew there were 50 states. ~ Anonymous,
107:Fourth, within the session, the learning should be spaced out. It is well known that massed training is much less effective than spaced training in creating enduring memories,74 including implicit memories of extinction.75 The explanation at the molecular level involves CREB, the transcription factor that initiates gene expression and protein synthesis in the conversion of short-term to long-term memory.76 Massed training depletes CREB, and once used up about sixty minutes of recovery is needed to replenish the supply, so additional training within that period only interferes with the resupply process.77 It has been shown that CREB-dependent protein synthesis in the PFCVM78 and amygdala79 is required for the long-term retention of extinction. So if one is going to do twenty-five exposures, they should be done in blocks of five, with breaks between, rather than all twenty-five at once. Temporal spacing, in short, could make the effects of extinction and exposure more persistent. ~ Joseph E LeDoux,
108:THOMAS JEFFERSON LEFT POSTERITY an immense correspondence, and I am particularly indebted to The Papers of Thomas Jefferson, published by Princeton University Press and first edited by Julian P. Boyd. I am, moreover, grateful to the incumbent editors of the Papers, especially general editor Barbara B. Oberg, for sharing unpublished transcripts of letters gathered for future volumes. The goal of the Princeton edition was, and continues to be, “to present as accurate a text as possible and to preserve as many of Jefferson’s distinctive mannerisms of writing as can be done.” To provide clarity and readability for a modern audience, however, I have taken the liberty of regularizing much of the quoted language from Jefferson and from his contemporaries. I have, for instance, silently corrected Jefferson’s frequent use of “it’s” for “its” and “recieve” for “receive,” and have, in most cases, expanded contractions and abbreviations and followed generally accepted practices of capitalization. ~ Jon Meacham,
109:I'm not stupid, Mr. Potter. What's the real reason you didn't tell me, and what were you actually doing with Mr. Malfoy?"

"Ah. Well..." Harry broke eye contact with her, and looked down at the library table.

"Draco Malfoy told the Aurors under Veritaserum that he wanted to know if he could beat me, so he challenged me to a duel to test it empirically. Those were his exact words according to the transcript."

"Right," Harry said, still not meeting her eyes. "Hermione Granger. Of course she'll remember the exact wording. It doesn't matter if she's chained to her chair, on trial for murder in front of the entire Wizengamot -"

"What were you really doing with Draco Malfoy?"

Harry winced, and said, "Probably not quite what you're thinking, but..."

The horror scaled and scaled within her, and finally broke loose.

"You were doing SCIENCE with him? "

"Well -"

"You were doing SCIENCE with him? You were supposed to be doing science with ME!  ~ Eliezer Yudkowsky,
110:When we learn, we alter which genes in our neurons are “expressed,” or turned on. Our genes have two functions. The first, the “template function,” allows our genes to replicate, making copies of themselves that are passed from generation to generation. The template function is beyond our control. The second is the “transcription function.” Each cell in our body contains all our genes, but not all those genes are turned on, or expressed. When a gene is turned on, it makes a new protein that alters the structure and function of the cell. This is called the transcription function because when the gene is turned on, information about how to make these proteins is “transcribed” or read from the individual gene. This transcription function is influenced by what we do and think. Most people assume that our genes shape us—our behavior and our brain anatomy. Kandel’s work shows that when we learn our minds also, affect which genes in our neurons are transcribed. Thus we can shape our genes, which in turn shape our brain’s microscopic anatomy. ~ Norman Doidge,
111:When I use the term the law of God here, I am not referring specifically to the Law given to the nation of Israel through Moses. Rather, I am using the term in a more general sense to refer to the transcript of God’s nature and the rule of obedience that He requires of all human beings. It includes all of the ethical commands scattered throughout the Bible. The standard of obedience required by the law is absolute perfection, for James 2:10 tells us, “For whoever keeps the whole law and yet stumbles at just one point is guilty of breaking all of it.” The apostle Paul said essentially the same thing when he wrote, “All who rely on observing the law are under a curse, for it is written: ‘Cursed is everyone who does not continue to do everything written in the Book of the Law’” (Galatians 3:10). Only perfect obedience is acceptable to God. Years ago Ivory soap had a slogan, “Ninety-nine-and-forty-four-onehundredths-percent pure.” Apparently that is quite an accomplishment for soap, but that is not good enough for God. Only 100 percent is acceptable. Yet the average person walking around ~ Jerry Bridges,
112:It was the magnesium. The addition of the ion was critical: with the solution supplemented with magnesium, the ribosome remained glued together, and Brenner and Jacob finally purified a miniscule amount of the messenger molecule out of bacterial cells. It was RNA, as expected-but RNA of a special kind. The messenger was generated afreah when a gene was translated. Like DNA, these RNA molecules were built by stringing together four bases-A,G,C, and U (in the RNA copy of a gene, remember, the T found in DNA is substituted for U). Notably, Brenner and Jacob later discovered the messenger RNA was a facsimile of the DNA chain-a copy made from the original. The RNA copy of a gene then moved from the nucleus to the cytosol, where its message was decoded to build a protein. The messenger RNA was neither an inhabitant of heaven nor of hell-but a professional go-between. The generation of an RNA copy of a gene was termed transcription-referring to the rewriting of a word or sentence in a language close to the original. A gene's code (ATGGGCC...) was transcribed into an RNA code (AUGGGCC...). ~ Siddhartha Mukherjee,
113: Let The Beasts Their Breath Resign
Let the beasts their breath resign,
Strangers to the life divine;
Who their God can never know,
Let their spirit downward go.
You for higher ends were born,
You may all to God return,
Dwell with him above the sky;
Why will you for ever die?
You, on whom he favours showers,
You, possest of nobler powers,
You, of reason's powers possest,
You, with will and memory blest,
You, with finer sense endued,
Creatures capable of God;
Noblest of his creatures, why,
Why will you for ever die?
You, whom he ordained to be
Transcripts of the Deity;
You, whom he in life doth hold;
You, for whom himself was sold;
You, on whom he still doth wait,
Whom he would again create;
Made by him, and purchased, why,
Why will you for ever die?
You, who own his record true,
You, his chosen people, you,
You, who call the Saviour Lord,
You, who read his written word,
You, who see the gospel-light,
Claim a crown in Jesu's right;
Why will you, ye Christians, why
Will the house of Israel die?
~ Charles Wesley,
114:White encouraged Updike’s equally scrupulous commitment. They bonded over dashes, colons, and commas—most amazingly in an exchange of letters in the last two months of 1954 concerning two poems, “The Sunflower” and “The Clan.” She wanted to make his punctuation consistent; he wanted to make his light verse flow in a manner pleasing to the ear and the eye. When he suggested changes to the proof of “Sunflower”—literally begging for a colon rather than a dash at the end of a particular line (“A colon is compact, firm, and balanced: a dash is sprawling, wishy-washy, and gawky. The colon suggests the Bible: the dash letters and memoirs of fashionable ladies”)—she replied with a three-page “treatise on punctuation” and a transcription of the relevant paragraph from H. W. Fowler’s Dictionary of Modern English Usage (the standard reference at The New Yorker, thanks to Harold Ross, who always kept a copy handy). She urged him to “try to feel more kindly toward the dash”—and closed with characteristic graciousness: “I want to add that I am delighted to find anyone who cares as much as this about punctuation and who is as careful as you are about your verse. . . . And I thank you for a very interesting and amusing letter. ~ Adam Begley,
115:Once inside his office, Cade took a seat at his desk and resolved, as he had many times over the last two weeks, to focus on work. He managed to do a decent job of that, putting himself on autopilot until the end of the day, when a knock on his office door interrupted him.

Vaughn stood in the doorway. “Thought I’d see if you want to grab a drink at O’Malley’s.”

Cade rubbed his face, realizing that he’d been reading audio transcripts for hours. “Sure.” He blinked, and then cocked his head. “I didn’t realize you had any meetings here today.”

“I didn’t.”

Huh. “Then why are you here?”

Vaughn shrugged. “I just figured you might, you know, need a drink.”

Cade frowned. “Why would you th—” Then it dawned on him. “Oh, no. You and I are not doing this. We are not having this conversation.” The idea of him and Vaughn having some sort of best friend heart-to-heart about his relationship troubles was laughable at best.

“You’ve been brooding for two weeks, Morgan. So yes, we are having this conversation.”

“I appreciate it, Vaughn. Really. But no offense—you suck at this stuff as much as I do.”

Vaughn tucked his hands into his pants pockets, not looking offended in the slightest. “Yep. And that’s why God made whiskey. ~ Julie James,
116:HMMs are at the heart of speech-recognition systems like Siri. In speech recognition, the hidden states are written words, the observations are the sounds spoken to Siri, and the goal is to infer the words from the sounds. The model has two components: the probability of the next word given the current one, as in a Markov chain, and the probability of hearing various sounds given the word being pronounced. (How exactly to do the inference is a fascinating problem that we’ll turn to after the next section.) Siri aside, you use an HMM every time you talk on your cell phone. That’s because your words get sent over the air as a stream of bits, and the bits get corrupted in transit. The HMM then figures out the intended bits (hidden state) from the ones received (observations), which it should be able to do as long as not too many bits got mangled. HMMs are also a favorite tool of computational biologists. A protein is a sequence of amino acids, and DNA is a sequence of bases. If we want to predict, for example, how a protein will fold into a 3-D shape, we can treat the amino acids as the observations and the type of fold at each point as the hidden state. Similarly, we can use an HMM to identify the sites in DNA where gene transcription is initiated and many other properties. ~ Pedro Domingos,
117:Going through old papers I came across the transcript of a university debate on Rublyov. God, what a level. Abysmal, pathetic. But there is one remarkable contribution by a maths professor called Manin, Lenin Prize winner, who can hardly be more than thirty. I share his views. Not that one should say that about oneself. But it's exactly what I felt when I was making Andrey. And I'm grateful to Manin for that.

"Almost every speaker has asked why they have to be made to suffer all through the three hours of the film. I'll try to reply to that question.
It is because the twentieth century has seen the rise of a kind of emotional inflation. When we read in a newspaper that two million people have been butchered in Indonesia, it makes as much impression on us as an account of our hockey team winning a match. The same degree of impression! We fail to notice the monstrous discrpancy between these two events. The channels of our perception have been smoothed out to the point where we are no longer aware. However, I don't want to preach about this. It may be that without it life would be impossible. Only the point is that there are some artists who do make us feel the true measure of things. It is a burden which they carry throughout their lives, and we must be thankful to them. ~ Andrei Tarkovsky,
118:Those who have not learned to read the ancient classics in the language in which they were written must have a very imperfect knowledge of the history of the human race; for it is remarkable that no transcript of them has ever been made into any modern tongue, unless our civilization itself may be regarded as such a transcript. Homer has never yet been printed in English, nor Æschylus, nor Virgil even—works as refined, as solidly done, and as beautiful almost as the morning itself; for later writers, say what we will of their genius, have rarely, if ever, equalled the elaborate beauty and finish and the lifelong and heroic literary labors of the ancients. They only talk of forgetting them who never knew them. It will be soon enough to forget them when we have the learning and the genius which will enable us to attend to and appreciate them. That age will be rich indeed when those relics which we call Classics, and the still older and more than classic but even less known Scriptures of the nations, shall have still further accumulated, when the Vaticans shall be filled with Vedas and Zendavestas and Bibles, with Homers and Dantes and Shakespeares, and all the centuries to come shall have successively deposited their trophies in the forum of the world. By such a pile we may hope to scale heaven at last. ~ Henry David Thoreau,
119:Nix to Declan:

Begin transcript
Testing. Hello, hellooo, anybody out there? Check, check, one, two. Soft pee. Puh, puh. Resonance! Sooooooft pee. Alpha bravo disco tango duck.
This is Nïx! I’m the Ever-Knowing One, a goddess incandescent, incomparable, and irresistible. But enough about what you think of me. It’s a beautiful day in New Orleans. The wind is out of the east at a steady five knots and clouds look like rabbits … But enough about what you think of me!
Now, down to business—
Squirrel!
Where was I? [Long pause] Why am I in Regin’s car? Bertil, you crawl right back out of that bong this minute!
Oh, I remember! I am hereby laying down this track for Magister Declan Chase. If you are a mortal of the recorder peon class, know that Dekko and I go waaaaay back, and he’ll go berserk (snicker snicker) if he doesn’t receive this transmittal. …
Chase, riddle me this: what’s beautiful but monstrous, long of tooth but sharp of tooth and soft of mind, and can never ever tell a lie?
That’s right. The Enemy of Old can be very useful to you. So use him already.
P.S. Your middle name’s about to be spelled r-e-g-r-e-t.
And with that, I must bid you adieu. Don’t worry, we’ll catch up very soon. …
[Muffled] Who’s mummy’s wittle echolocator? That’s right—you are!
—End transcript ~ Kresley Cole,
120: Joan Of Arc
She and the fire
fight adjectives. Their concreteness
deflects reification
by language. She simply is
a pronoun. It may signify
say, my wife (coming from me
'she' often does) or, yes
a medieval French woman, her being
so roughly abridged
by the pronoun, as brutally fed
to the fire. Regarding the fire
dazzling, heaving, devouring
won't do. It only suggests
a familiar occurrence: ouch
when flame touches skin. Indeed
flame doesn't suffice (rhymes with lame)
and a pyre, much more poetic,
based on the transcripts based on
wordy statements. So much
reliance on the makeshift engine
of abstraction, language. She
did, I think, end in fire, but hero
saint, witch, schizophrenic
won't do. Will numbers rectify
the flaws of alphabetical signs: 1412
to 1431? Historians can't be certain
56
about either: no records
other than her reserved guess
on the first day of trial
apropos birth, and her famed death
also contested by theorists
of bad conspiracies. So I can't
force the ephemeral stuff
of her matter into a mould (a poem)
with description, facts
or even an attempted evocation. She
floats and evades
perhaps - if I may hazard a simile like her ashes, diffused
by an English guard over the Seine.
~ Ali Alizadeh,
121:Given the complexity of the chore, “escapees,” as free-floating fecal material is known in astronautical circles, plagued the crews. Below is an excerpt from the Apollo 10 mission transcript, starring Mission Commander Thomas Stafford, Lunar Module Pilot Gene Cernan, and Command Module Pilot John Young, orbiting the moon 200,000-plus miles from the nearest bathroom. CERNAN:…You know once you get out of lunar orbit, you can do a lot of things. You can power down…And what’s happening is— STAFFORD: Oh—who did it? YOUNG: Who did what? CERNAN: What? STAFFORD: Who did it? [laughter] CERNAN: Where did that come from? STAFFORD: Give me a napkin quick. There’s a turd floating through the air. YOUNG: I didn’t do it. It ain’t one of mine. CERNAN: I don’t think it’s one of mine. STAFFORD: Mine was a little more sticky than that. Throw that away. YOUNG: God almighty. [And again eight minutes later, while discussing the timing of a waste-water dump.] YOUNG: Did they say we could do it anytime? CERNAN: They said on 135. They told us that—Here’s another goddam turd. What’s the matter with you guys? Here, give me a— YOUNG/STAFFORD: [laughter]… STAFFORD: It was just floating around? CERNAN: Yes. STAFFORD: [laughter] Mine was stickier than that. YOUNG: Mine was too. It hit that bag— CERNAN: [laughter] I don’t know whose that is. I can neither claim it nor disclaim it. [laughter] YOUNG: What the hell is going on here? ~ Mary Roach,
122:I don't get it?" she asked "I don't get it? Let me tell you something about what I get. You think you're so smart? I spent three years on a full academic scholarship at the best college-prep school in the country. And when they kicked me out I had to petition-petition!-to keep them from wiping out my four-point-oh transcript."
Daniel moved away, but Luce pursued him, taking a step forward for every wide-eyed step he took back. Probably freaking him out, but so what? He'd been asking for it every time he condescended to her.
"I know Latin and French, and in middle school, I won the science fair three years in a row."
She had backed him up against the railing of the boardwalk and was trying to restrain herself from poking him in the chest with her finger. She wasn't finished.
"I also do the Sunday crossword puzzle, sometimes in under an hour. I have an unerringly good sense of direction... though not always when it comes to guys."
She swallowed and took a moment to catch her breath.
"And someday, I'm going to be a psychiatrist who actually listens to her patients and helps people. Okay? So don't keep talking to me like I'm stupid and don't tell me I don't understand just because I can't decode your erratic, flaky, hot-one-minute-cold-the-next, frankly"-she looked up at him, letting out her breath-"really hurtful behavior." She brushed a tear away, angry with herself for getting so worked up. ~ Lauren Kate,
123:Working independently, Baltimore and Temin discovered an enzyme found in retroviruses that could build DNA from an RNA template. They called the enzyme reverse transcriptase-"reverse" because it inverted the normal direction of information flow: from RNA back to DNA, or from a gene's message backward to a gene, thereby violating Crick's "central dogma" (that genetic information only moved from genes to messages, but never backward).

Using reverse transcriptase, ever RNA in a cell could be used as a template to build its corresponding gene. A biologist could thus generate a catalog, or "library" of all "active" genes in a cell-akin to a library of books grouped by subject. There would be a library of genes for T cells and another for red blood cells, a library for neurons in the retina, for insulin-secreting cells of the pancreas, and so forth. By comparing libraries derived from two cells-a T cell and a pancreas cell, say-an immunologist could fish out genes that were active in one cell and not the other (e.g., insulin or the T cell receptor). Once identified, that gene could be amplified a millionfold in bacteria. The gene could be isolated and sequenced, its RNA and protein sequence determined, its regulatory regions identified; it could be mutated an inserted into a different cell to decipher the gene's structure and function. In 1984 this technique was deployed to clone the T cell receptor-a landmark achievement in immunology. ~ Siddhartha Mukherjee,
124:Less than a decade later there was experimental support for the right hemispheric involvement of “intrusive” experiences into awareness. Although imaging technology has shown us that the cerebral volume in which “mind space” exists is configurational and complex, the results strongly support Jaynes’s essential thesis. But perhaps the most compelling congruence with Jaynes’s insights is genetics. Within the last five years science has found that single point mutations on genes can produce permanent changes in speech production. There is now evidence that point mutations, whose mechanisms must still be discerned, can diffuse within decades throughout entire populations. There have been approximately 15 million changes in our species’ genome since our common ancestor with the chimpanzee. There are human accelerated regions in the genome with genes known to be involved in transcriptional regulation and neurodevelopment. They are expressed within brain structures that would have allowed precisely the types of phenomena that Jaynes predicted had occurred around 3,500 years ago. Related genes, attributed to religious beliefs, are found on the same chromosome (for example, chromosome 10) as propensities for specific forms of epilepsy (partial, with auditory features) and schizophrenia. From what we now know about antibody titres and viral infections, the concept of a relatively swift and pervasive change in the microstructure and function of all human brains is no longer that improbable. ~ Marcel Kuijsten,
125:Why aren't you in school? I see you every day wandering around."
"Oh, they don't miss me," she said. "I'm antisocial, they say. I don't mix. It's so strange. I'm very social indeed. It all depends on what you mean by social, doesn't it? Social to me means talking to you about things like this." She rattled some chestnuts that had fallen off the tree in the front yard. "Or talking about how strange the world is. Being with people is nice. But I don't think it's social to get a bunch of people together and then not let them talk, do you? An hour of TV class, an hour of basketball or baseball or running, another hour of transcription history or painting pictures, and more sports, but do you know, we never ask questions, or at least most don't; they just run the answers at you, bing, bing, bing, and us sitting there for four more hours of film-teacher. That's not social to me at all. It's a lot of funnels and lot of water poured down the spout and out the bottom, and them telling us it's wine when it's not. They run us so ragged by the end of the day we can't do anything but go to bed or head for a Fun Park to bully people around, break windowpanes in the Window Smasher place or wreck cars in the Car Wrecker place with the big steel ball. Or go out in the cars and race on the streets, trying to see how close you can get to lampposts, playing 'chicken' and 'knock hubcaps.' I guess I'm everything they say I am, all right. I haven't any friends. That's supposed to prove I'm abnormal. But everyone I know is either shouting or dancing around like wild or beating up one another. Do you notice how people hurt each other nowadays? ~ Ray Bradbury,
126:In 2014, the American media exploded with news of ISIS beheadings in Syria—six thousand miles away from the United States. Meanwhile, the beheading capital of the world is just to our south, a stone’s throw from American homes, businesses, and ranches. When the Islamic State of Iraq and Syria first began posting videotaped beheadings online, it was as if no one had ever heard of such barbarity. In fact, decapitation porn was an innovation of the Mexican drug cartels.45 One “ISIS” video circulating in 2014 showed a man being beheaded with a chain saw. Then it turned out the video wasn’t an ISIS beheading, at all: It was a Mexican video from 2010.46 After American David Hartley was shot and killed by Mexican drug cartel members while jet skiing with his wife at a lake on the Mexican border, the lead investigator on the case was murdered and his head delivered in a suitcase to a nearby military installation.47 In 2013, there was a huge outcry over Facebook’s video-sharing policy when an extremely graphic video of a man beheading a woman appeared on the site. That, too, was a product of Mexico.48 Where is the 24-7 coverage for these champion beheaders? If it seems like you never hear about all the dismemberments in Mexico, you’d be right. In a search of all transcripts in the Nexis archive in the first eight months of ISIS’s existence as a jihadist group, “beheading” was used in the same sentence as “ISIS” or “ISIL” 1,629 times. During that same time period, it was used in the same sentence as “Mexico” or “Mexican” twice. Indeed, in the previous five years Mexican beheadings were mentioned only sixty-six times.49 If a tree falls and beheads a woman in Mexico, does anyone hear it? ~ Ann Coulter,
127:Debra pointed her purses lips in Max’s direction. “Overnight guests are forbidden. No exceptions.”
“Did you just have the audacity to judge me?” Gina blocked the nurse’s route to the door. “Without knowing the least little thing about me?”
Debra lifted an eyebrow. “Well, I have seen your underwear, dear.”
“Exactly,” Gina said. “You’ve seen my underwear—not my personality profile, or my resume, or my college transcript, or—”
“If you think for one second,” the nurse countered, “that anything about this situation is even remotely unique—”
“That’s enough,” Max said.
Gina, of course, ignored him. “I don’t just think it, I know it,” she said. “It’s unique because I’m unique, because Max is unique, because—”
Debra finally laughed. “Oh, honey, you are so . . . young. Here’s a tip I don’t usually bother to tell girls like you: If I find one pair of panties on the floor, it’s only a matter of time before I find another. And I hate to break it to you, hon, but the girl who comes out of the bathroom next time, well . . . She isn’t going to be you.”
“First of all,” Gina said grimly, “I’m a woman, not a girl. And second, Grandma . . . You want to bet it’s not going to be me?”
“I said, that’s enough,” Max repeated, and they both turned to look at him. About time. He was used to clearing his throat and having an entire room jump to full attention. “Ms. Forsythe, you took my blood pressure—you have the information you needed, good day to you, ma’am. Gina . . .” He wanted to tell her to untwist her panties and put them back on, but he didn’t dare. “Sit,” he ordered instead, motioning to the desk chair that could be pulled beside the bed. “Please,” he added when Nurse Evil smirked on her way out the door. ~ Suzanne Brockmann,
128:As I write this, I’m sitting in a café in Paris overlooking the Luxembourg Garden, just off of Rue Saint-Jacques. Rue Saint-Jacques is likely the oldest road in Paris, and it has a rich literary history. Victor Hugo lived a few blocks from where I’m sitting. Gertrude Stein drank coffee and F. Scott Fitzgerald socialized within a stone’s throw. Hemingway wandered up and down the sidewalks, his books percolating in his mind, wine no doubt percolating in his blood. I came to France to take a break from everything. No social media, no email, no social commitments, no set plans . . . except one project. The month had been set aside to review all of the lessons I’d learned from nearly 200 world-class performers I’d interviewed on The Tim Ferriss Show, which recently passed 100,000,000 downloads. The guests included chess prodigies, movie stars, four-star generals, pro athletes, and hedge fund managers. It was a motley crew. More than a handful of them had since become collaborators in business and creative projects, spanning from investments to indie film. As a result, I’d absorbed a lot of their wisdom outside of our recordings, whether over workouts, wine-infused jam sessions, text message exchanges, dinners, or late-night phone calls. In every case, I’d gotten to know them well beyond the superficial headlines in the media. My life had already improved in every area as a result of the lessons I could remember. But that was the tip of the iceberg. The majority of the gems were still lodged in thousands of pages of transcripts and hand-scribbled notes. More than anything, I longed for the chance to distill everything into a playbook. So, I’d set aside an entire month for review (and, if I’m being honest, pain au chocolat), to put together the ultimate CliffsNotes for myself. It would be the notebook to end all notebooks. Something that could help me in minutes but be read for a lifetime. ~ Timothy Ferriss,
129:(Jen gets completely sloshed and it's not her wedding)

I was supposed to meet Carol and her family at the aquarium the next morning, and somehow had the presence of mind to leave a voicemail apologizing in advance for not being able to make it. I was please at myself for being so responsible and considerate. After I left the message, I blissfully headed off to bed, wearing a face full of makeup, all my grown up jewelry, and a relatively restrictive girdle.

Suffice it to say, yesterday was rough, what with my apartment spinning and all.

But today I felt better. That is, until Carol played me the voice mail I left for her at 1:03 AM. Somehow I thought I had been able to hold it together on the phone. Following is a transcript of the message I left:

30 seconds of heavy breathing, giggling, and intermittent hiccups (At first Carol thought it was a 911 call.)

Oh, heeheehee, I waassshh wayyyting for a beep. But noooooo beeeeeeep. Why don't you hash a beep on your, your, ummmmmm...celery phone? Noooooo beeeeeeep, hic, heeheeeheee.

Um, hiiiiii, itsch JEENNNNNNNN!! It's thirteen o'clock in the peeeeeee eeeemmmmmmm. Heeeeeeeellllllllllloooooooo! I went to my wedding tonight and it wash sooooo niiiiiiiiiice. Hic."

More giggling and the sound of a phone being dropped and retrieved

Nannyway, I am calling to telllll you noooooooooo fishies tomorry...no fishies for meeee! I hic, heeeee, can't smake it to the quariyummm. Maybeeee you can call me so I can say HIIIIIIIIIIIIIII later hich in the day hee hee hee. Call me at, um, 312, ummmmmmm, 312, uummmmm, hee hee hee I can't member my phone, Hic. Do you know my number? Can you call me and tell me what it isssch? I LIKESH TURKEY SAMMICHES!

10 seconds of chewing, giggling, and what may be gobbling sounds

Okay, GGGGGGGGooooooodniiiiiiiiiggggggggggggghhhhhhhhhhhttttt! No fish! Um, how do I turn this tthing off? Shhhhh, callllls' over. Beeee quiiiiiiietttt, hee hee hee."

15 more seconds of giggles, hiccups, shushing, and a great deal of banging

Perhaps this is why most people only have one wedding? ~ Jen Lancaster,
130:Maybe it was because of his ignorance of music that he had been capable of receiving so confused an impression, the kind of impression that is, however, perhaps the only one which is purely musical, immaterial, entirely original, irreducible to any other order of impression. An impression of this kind is, for an instant, so to speak, sine materia. No doubt the notes we hear then tend already, depending on their loudness and their quantity, to spread out before our eyes over surfaces of varying dimensions, to trace arabesques, to give us sensations of breadth, tenuousness, stability, whimsy. But the notes vanish before these sensations are sufficiently formed in us not to be submerged by those already excited by the succeeding or even simultaneous notes. And this impression would continue to envelop with its liquidity and its “mellowness” the motifs that at times emerge from it, barely discernible, immediately to dive under and disappear, known only by the particular pleasure they give, impossible to describe, to recall, to name, ineffable—if memory, like a laborer working to put down lasting foundations in the midst of the waves, by fabricating for us facsimiles of these fleeting phrases, did not allow us to compare them to those that follow them and to differentiate them. And so, scarcely had the delicious sensation which Swann had felt died away than his memory at once furnished him with a transcription that was summary and temporary but at which he could glance while the piece continued, so that already, when the same impression suddenly returned, it was no longer impossible to grasp. He could picture to himself its extent, its symmetrical groupings, its notation, its expressive value; he had before him this thing which is no longer pure music, which is drawing, architecture, thought, and which allows us to recall the music. This time he had clearly distinguished one phrase rising for a few moments above the waves of sound. It had immediately proposed to him particular sensual pleasures which he had never imagined before hearing it, which he felt could be introduced to him by nothing else, and he had experienced for it something like an unfamiliar love. ~ Marcel Proust,
131:A word of explanation about how the information in this book was obtained, evaluated and used. This book is designed to present, as best my reporting could determine, what really happened. The core of this book comes from the written record—National Security Council meeting notes, personal notes, memos, chronologies, letters, PowerPoint slides, e-mails, reports, government cables, calendars, transcripts, diaries and maps. Information in the book was supplied by more than 100 people involved in the Afghanistan War and national security during the first 18 months of President Barack Obama’s administration. Interviews were conducted on “background,” meaning the information could be used but the sources would not be identified by name. Many sources were interviewed five or more times. Most allowed me to record the interviews, which were then transcribed. For several sources, the combined interview transcripts run more than 300 pages. I have attempted to preserve the language of the main characters and sources as much as possible, using their words even when they are not directly quoted, reflecting the flavor of their speech and attitudes. Many key White House aides were interviewed in-depth. They shared meeting notes, important documents, recollections of what happened before, during and after meetings, and assisted extensively with their interpretations. Senior and well-placed military, intelligence and diplomatic officials also provided detailed recollections, read from notes or assisted with documents. Since the reporting was done over 18 months, many interviews were conducted within days or even hours after critical discussions. This often provided a fresher and less-calculated account. Dialogue comes mostly from the written record, but also from participants, usually more than one. Any attribution of thoughts, conclusions or feelings to a person was obtained directly from that person, from notes or from a colleague whom the person told. Occasionally, a source said mid-conversation that something was “off-the-record,” meaning it could not be used unless the information was obtained elsewhere. In many cases, I was able to get the information elsewhere so that it could be included in this book. Some people think they can lock up and prevent publication of information by declaring it “off-the-record” or that they don’t want to see it in the book. But inside any White House, nearly everyone’s business and attitudes become known to others. And in the course of multiple, extensive interviews with firsthand sources about key decision points in the war, the role of the players became clear. Given the diversity of sources, stakes and the lives involved, there is no way I could write a sterilized or laundered version of this story. I interviewed President Obama on-the-record in the Oval Office for one hour and 15 minutes on Saturday, July 10, 2 ~ Bob Woodward,
132:I know people who read interminably, book after book, from page to page, and yet I
should not call them 'well-read people'. Of course they 'know' an immense amount; but
their brain seems incapable of assorting and classifying the material which they have
gathered from books. They have not the faculty of distinguishing between what is
useful and useless in a book; so that they may retain the former in their minds and if
possible skip over the latter while reading it, if that be not possible, then--when once
read--throw it overboard as useless ballast. Reading is not an end in itself, but a means
to an end. Its chief purpose is to help towards filling in the framework which is made
up of the talents and capabilities that each individual possesses. Thus each one procures
for himself the implements and materials necessary for the fulfilment of his calling in
life, no matter whether this be the elementary task of earning one's daily bread or a
calling that responds to higher human aspirations. Such is the first purpose of reading.
And the second purpose is to give a general knowledge of the world in which we live.
In both cases, however, the material which one has acquired through reading must not
be stored up in the memory on a plan that corresponds to the successive chapters of the
book; but each little piece of knowledge thus gained must be treated as if it were a little
stone to be inserted into a mosaic, so that it finds its proper place among all the other
pieces and particles that help to form a general world-picture in the brain of the reader.
Otherwise only a confused jumble of chaotic notions will result from all this reading.
That jumble is not merely useless, but it also tends to make the unfortunate possessor of
it conceited. For he seriously considers himself a well-educated person and thinks that
he understands something of life. He believes that he has acquired knowledge, whereas
the truth is that every increase in such 'knowledge' draws him more and more away
from real life, until he finally ends up in some sanatorium or takes to politics and
becomes a parliamentary deputy.
Such a person never succeeds in turning his knowledge to practical account when the
opportune moment arrives; for his mental equipment is not ordered with a view to
meeting the demands of everyday life. His knowledge is stored in his brain as a literal
transcript of the books he has read and the order of succession in which he has read
them. And if Fate should one day call upon him to use some of his book-knowledge for
certain practical ends in life that very call will have to name the book and give the
number of the page; for the poor noodle himself would never be able to find the spot
where he gathered the information now called for. But if the page is not mentioned at
the critical moment the widely-read intellectual will find himself in a state of hopeless
embarrassment. In a high state of agitation he searches for analogous cases and it is
almost a dead certainty that he will finally deliver the wrong prescription. ~ Adolf Hitler,
133:Quant à l’oeuvre, les problèmes qu’elle soulève sont plus difficiles encore. En apparence pourtant, quoi de plus simple ? Une somme de textes qui peuvent être dénotés par le signe d’un nom propre. Or cette dénotation (même si on laisse de côté les problèmes de l’attribution) n’est pas une fonction homogène : le nom d’un auteur dénote-t-il de la même façon un texte qu’il a lui-même publié sous son nom, un texte qu’il a présenté sous un pseudonyme, un autre qu’on aura retrouvé après sa mort à l’état d’ébauche, un autre encore qui n’est qu’un griffonnage, un carnet de notes, un « papier » ? La constitution d’une oeuvre complète ou d’un opus suppose un certain nombre de choix qu’il n’est pas facile de justifier ni même de formuler : suffit-il d’ajouter aux textes publiés par l’auteur ceux qu’il projetait de donner à l’impression, et qui ne sont restés inachevés quer par le fait de la mort ? Faut-il intégrer aussi tout ce qui est brouillon, fait de la mort ? Faut-il intégrer aussi tout ce qui est brouillon, premier dessein, corrections et ratures des livres ? Faut-il ajouter les esquisses abandonnées? Et quel status donner aux lettres, aux notes, aux conversations rapportées, aux propos transcrits par les auditeurs, bref à cet immense fourmillement de traces verbales qu’un individu laisse autour de lui au moment de mourir, et qui parlent dans un entrecroisement indéfini tant de langages différents ? En tout cas le nom « Mallarmé » ne se réfère pas de la même façon aux thèmes anglais, aux trauctions d’Edgar Poe, aux poèmes, ou aux réponses à des enquêtes ; de même, ce n’est pas le même rapport qui existe entre le nom de Nietzsche d’une part et d’autre par les autobiographies de jeunesse, les dissertations scolaires, les articles philologiques, Zarathoustra, Ecce Homo, les lettres, les dernières cartes postales signées par « Dionysos » ou « Kaiser Nietzsche », les innombrables carnets où s’enchevêtrent les notes de blanchisserie et les projets d’aphorismes. En fait, si on parle si volontiers et sans s’interroger davantage de l’« oeuvre » d’un auteur, c’est qu’on la suppose définie par une certaine fonction d’expression. On admet qu’il doit y avoir un niveau (aussi profond qu’il est nécessaire de l’imaginer) auquel l’oeuvre se révèle, en tous ses fragments, même les plus minuscules et les plus inessentiels, comme l’expression de la pensée, ou de l’expérience, ou de l’imagination, ou de l’inconscient de l’auteur, ou encore des déterminations historiques dans lesquelles il était pris. Mais on voit aussitôt qu’une pareille unité, loin d’être donné immédiatement, est constituée par une opération ; que cette opération est interprétative (puisqu’elle déchiffre, dans le texte, la transcription de quelque chose qu’il cache et qu’il manifeste à la fois); qu’enfin l’opération qui détermine l’opus, en son unité, et par conséquent l’oeuvre elle-même ne sera pas la même s’il s’agit de l’auteur du Théâtre et son double ou de l’auteur du Tractatus et donc, qu’ici et là ce n’est pas dans le même sens qu’on parlera d’une « oeuvre ». L’oeuvre ne peut être considérée ni comme unité immédiate, ni comme une unité certaine, ni comme une unité homogène. ~ Michel Foucault,
134: Transcription Of Organ Music
The flower in the glass peanut bottle formerly in the
kitchen crooked to take a place in the light,
the closet door opened, because I used it before, it
kindly stayed open waiting for me, its owner.
I began to feel my misery in pallet on floor, listening
to music, my misery, that's why I want to sing.
The room closed down on me, I expected the presence
of the Creator, I saw my gray painted walls and
ceiling, they contained my room, they contained
me
as the sky contained my garden,
I opened my door
The rambler vine climbed up the cottage post,
the leaves in the night still where the day had placed
them, the animal heads of the flowers where they had
arisen
to think at the sun
Can I bring back the words? Will thought of
transcription haze my mental open eye?
The kindly search for growth, the gracious desire to exist of the flowers, my near ecstasy at existing
among them
The privilege to witness my existence-you too
must seek the sun...
My books piled up before me for my use
waiting in space where I placed them, they
haven't disappeared, time's left its remnants and qualities for me to use--my words piled up, my texts, my
manuscripts, my loves.
I had a moment of clarity, saw the feeling in
the heart of things, walked out to the garden crying.
Saw the red blossoms in the night light, sun's
gone, they had all grown, in a moment, and were waiting stopped in time for the day sun to come and give
them...
89
Flowers which as in a dream at sunset I watered
faithfully not knowing how much I loved them.
I am so lonely in my glory--except they too out
there--I looked up--those red bush blossoms beckoning and peering in the window waiting in the blind love,
their leaves too have hope and are upturned top flat
to the sky to receive--all creation open to receive--the
flat earth itself.
The music descends, as does the tall bending
stalk of the heavy blssom, because it has to, to stay
alive, to continue to the last drop of joy.
The world knows the love that's in its breast as
in the flower, the suffering lonely world.
The Father is merciful.
The light socket is crudely attached to the ceiling, after the house was built, to receive a plug which
sticks in it alright, and serves my phonograph now...
The closet door is open for me, where I left it,
since I left it open, it has graciously stayed open.
The kitchen has no door, the hole there will
admit me should I wish to enter the kitchen.
I remember when I first got laid, H.P. graciously took my cherry, I sat on the docks of Provincetown, age 23, joyful, elevated in hope with the
Father, the door to the womb wasopen to admit me
if I wished to enter.
There are unused electricity plugs all over my
house if I ever needed them.
The kitchen window is open, to admit air...
The telephone--sad to relate--sits on the
floor--I haven't had the money to get it connected-I want people to bow when they see me and say
he is gifted with poetry, he has seen the presence of
the Creator
And the Creator gave me a shot of his presence
to gratify my wish, so as not to cheat me of my yearning
for him.
90
~ Allen Ginsberg,
135:Babel led to an explosion in the number of languages. That was part of Enki's plan. Monocultures, like a field of corn, are susceptible to infections, but genetically diverse cultures, like a prairie, are extremely robust. After a few thousand years, one new language developed - Hebrew - that possessed exceptional flexibility and power. The deuteronomists, a group of radical monotheists in the sixth and seventh centuries B.C., were the first to take advantage of it. They lived in a time of extreme nationalism and xenophobia, which made it easier for them to reject foreign ideas like Asherah worship. They formalized their old stories into the Torah and implanted within it a law that insured its propagation throughout history - a law that said, in effect, 'make an exact copy of me and read it every day.' And they encouraged a sort of
informational hygiene, a belief in copying things strictly and taking great care with information, which as they understood, is potentially dangerous. They made data a controlled substance... [and] gone beyond that. There is evidence of carefully planned biological warfare against the army of Sennacherib when he tried to conquer Jerusalem. So the deuteronomists may have had an en of their very own. Or maybe they just understood viruses well enough that they knew how to take
advantage of naturally occurring strains. The skills cultivated by these people were passed down in secret from one generation to the next and manifested themselves two thousand years later, in Europe, among the Kabbalistic sorcerers, ba'al shems, masters of the divine name.
In any case, this was the birth of rational religion. All of the subsequent monotheistic religions - known by Muslims, appropriately, as religions of the
Book - incorporated those ideas to some extent. For example, the Koran states over and over again that it is a transcript, an exact copy, of a book in Heaven. Naturally, anyone who believes that will not dare to alter the text in any way! Ideas such as these were so effective in preventing the spread of Asherah that, eventually, every square inch of the territory where the viral cult had once thrived was under the sway of Islam, Christianity, or Judaism.
But because of its latency - coiled about the brainstem of those it infects, passed from one generation to the next - it always finds ways to resurface. In the case of Judaism, it came in the form of the Pharisees, who imposed a rigid
legalistic theocracy on the Hebrews. With its rigid adherence to laws stored in a temple, administered by priestly types vested with civil authority, it
resembled the old Sumerian system, and was just as stifling.
The ministry of Jesus Christ was an effort to break Judaism out of this condition... an echo of what Enki did. Christ's gospel is a new namshub,
an attempt to take religion out of the temple, out of the hands of the priesthood, and bring the Kingdom of God to everyone. That is the message
explicitly spelled out by his sermons, and it is the message symbolically embodied in the empty tomb. After the crucifixion, the apostles went to his
tomb hoping to find his body and instead found nothing. The message was clear enough; We are not to idolize Jesus, because his ideas stand alone, his church is no longer centralized in one person but dispersed among all the people. ~ Neal Stephenson,
136:Bold prayers honor God, and God honors bold prayers. God isn’t offended by your biggest dreams or boldest prayers. He is offended by anything less. If your prayers aren’t impossible to you, they are insulting to God.

Prayers are prophecies. They are the best predictors of your spiritual future. Who you become is determined by how you pray. Ultimately, the transcript of your prayers becomes the script of your life.

The greatest tragedy in life is the prayers that go unanswered because they go unasked.

God does not answer vague prayers. The more specific your prayers are, the more glory God receives.

Most of us don’t get what we want because we quit praying. We give up too easily. We give up too soon. We quit praying right before the miracle happens.

If you don’t take the risk, you forfeit the miracle.

Take a step of faith when God gives you a vision because you trust that the One who gave you the vision is going to make provision. And for the record, if the vision is from God, it will most definitely be beyond your means.

We shouldn’t seek answers as much as we should seek God. If you seek answers you won’t find them, but if you seek God, the answers will find you.

If your plans aren’t birthed in prayer and bathed in prayer, they won’t succeed.

Are your problems bigger than God, or is God bigger than your problems? Our biggest problem is our small view of God. That is the cause of all lesser evils. And it’s a high view of God that is the solution to all other problems.

Because you know He can, you can pray with holy confidence.

Persistence is the magic bullet. The only way you can fail is if you stop praying. 100 percent of the prayers I don’t pray won’t get answered.

Where are you most proficient, most sufficient? Maybe that is precisely where God wants you to trust Him to do something beyond your ability.

What we perceive as unanswered prayers are often the greatest answers. Our heavenly Father is far too wise and loves us far too much to give us everything we ask for. Someday we’ll thank God for the prayers He didn’t answer as much or more than the ones He did.

You can’t pray for open doors if you aren’t willing accept closed doors, because one leads to the other.

Just as our greatest successes often come on the heels of our greatest failures, our greatest answers often come on the heels of our longest and most boring prayers.

The biggest difference between success and failure, both spiritually and occupationally, is your waking-up time on your alarm clock. We won’t remember the things that came easy; we’ll remember the things that came hard.

It’s not just where you end up that’s important; it’s how you get there. Goal setting begins and ends with prayer.

The more you have to circle something in prayer, the more satisfying it is spiritually. And, often, the more glory God gets.

I don’t want easy answers or quick answers because I have a tendency to mishandle the blessings that come too easily or too quickly. I take the credit or take them for granted. So now I pray that it will take long enough and be hard enough for God to receive all of the glory. Change your prayer approach from as soon as possible to as long as it takes.

Go home. Lock yourself in your room. Kneel down in the middle of the floor, and with a piece of chalk draw a circle around yourself. There, on your knees, pray fervently and brokenly that God would start a revival within that chalk circle. ~ Mark Batterson,
137: was also renowned in Japan. Burton Watson says of ~ Bai Juyi



: "he worked to
develop a style that was simple and easy to understand, and posterity has
requited his efforts by making him one of the most well-loved and widely read of
all Chinese poets, both in his native land and in the other countries of the East
that participate in the appreciation of Chinese culture. He also, thanks to the
translations and biographical studies by Arthur Waley, one of the most accessible
to English readers". Today the fame of ~ Bai Juyi



is worldwide.
Name variants
Names
Pinyin: Bó Juyì or Bái Juyì
Wade-Giles: Po Chü-i or Pai Chü-i
Zì : Lètian
Hào : Xiangshan Jushì
Zuìyín Xiansheng
Shì Wén (hence referred
to as Bái Wéngong )
~ Bai Juyi



often referred to himself in life as Letian, the older English transcription
version being Lo-t'ien, meaning something like "happy-go-lucky". Later in life, he
referred to himself as the Hermit of Xiangshan.
Life
~ Bai Juyi



lived during the Middle Tang period. This was a period of rebuilding and
recovery for the Tang Empire, following the An Shi Rebellion, and following the
poetically flourishing era famous for Li Bo (701-762), Wang Wei (701-761), and
Du Fu (712-770). ~ Bai Juyi



lived through the reign of eight or nine emperors,
being born in the Dali regnal era (766-779) of Emperor Daizong of Tang. He had
a long and successful career both as a government official and a poet, although
these two facets of his career seemed to have come in conflict with each other at
certain points. ~ Bai Juyi



was also a devoted Chan Buddist.
Birth and childhood
~ Bai Juyi



was born in 772, in Taiyuan, Shanxi, which was then a few miles from
location of the modern city. Although he was in Zhengyang, Henan for most of
his childhood. His family was poor but scholarly, his father being an Assistant
Department Magistrate of the second-class. At the age of ten he was sent away
from his family to avoid a war that broke out in the north of China, and went to
live with relatives in the area known as Jiangnan, more specifically Xuzhou.
Early career
~ Bai Juyi



's official career was initially successful. He passed the jinshi
examinations in 800. ~ Bai Juyi



may have taken up residence in the western capital
city of Chang'an, in 801. Not long after this, ~ Bai Juyi



and formed a long
friendship with a scholar Yuan Zhen. ~ Bai Juyi



's father died in 804, and the young
Bai spent the traditional period of retirement mourning the death of his parent,
which he did along the Wei River, near to the capital. 806 was the first full year
of the reign of Emperor Xianzong of Tang. Also, 806 was the ~ Bai Juyi



was
appointed to a minor post as a government official, at Zhouzhi, which was not far
from the Chang'an (and also in Shaanxi province). He was made a member
(scholar) of the Hanlin Academy, in 807, and Reminder of the Left from 807 until
815, except in 811 when his mother died. He spent the traditional three year
mourning period again along the Wei River, and returned to court in the winter of
814, where he held the title of Assistant Secretary to the Prince's Tutor. It was
not a high ranking position, but nevertheless one which he was soon to lose.
Exile
While serving as a minor palace official, 814, Bei Juyi managed to get himself in
official trouble. He made a few enemies at court and with certain individuals in
other positions. It was partly his written works which lead him into trouble. He
wrote two long memorials, translated by Arthur Waley as "On Stopping the War",
regarding what he considered to be an overly lengthy campaign against a minor
group of Tatars; and he wrote a series of poems, in which he satirized the actions
of greedy officials and highlighting the sufferings of the common folk.
At this time, one of the post-An Lushan warlords (jiedushi), Wu Yuanji in Henan,
had seized control of Zhangyi Circuit (centered in Zhumadian), an act for which
he sought reconciliation with the imperial government, trying to get an imperial
pardon as a necessary prerequisite. Despite the intercession of influential friends,
Wu was denied, thus officially putting him in the position of rebellion. Still
seeking a pardon, Wu turned to assassination, blaming the Prime Minister
(another Wu, Wu Yuanheng) and other officials: the imperial court generally
began by dawn, requiring the ministers to rise early in order to attend in a timely
manner; and, on July 13, 815, before dawn, the Tang Prime Minister Wu
Yuanheng was set to go to the palace for a meeting with Emperor Xianzong. As
he left his house, arrows were fired at his retinue. His servants all fled, and the
assassins seized Wu Yuanheng and his horse, and then decapitated him, taking
his head with them. The assassins also attacked another official who favored the
campaign against the rebellious warlords, Pei Du, but was unable to kill him. The
people at the capital were shocked and there was turmoil, with officials refusing
to leave their personal residences until after dawn.
In this context, ~ Bai Juyi



overstepped his minor position by memorializing the
emperor. As Assistant Secretary to the Prince's Tutor, Bai's memorial was a
breach of protocol — he should have waited for those of censorial authority to
take the lead before offering his own criticism. This was not the only charge
which his opponents used against him. His mother had died, apparently caused
by falling into a well while looking at some flowers, and two poems written by Bai
Juyi — the titles of which Waley translates as "In Praise of Flowers" and "The
New Well" — were used against him as a sign of lack of Filial Piety, one of the
Confucian ideals. The result was exile: ~ Bai Juyi



was demoted to the rank of SubPrefect and banished from the court and the capital city to Jiujiang, then known
as Xun Yang on the southern shores of the Yangtze River in northwest Jiangxi
Province, China. After three years he was sent as Governor of a remote place in
Sichuan. At the time, the main travel route there was up the Yangzi River. This
trip allowed ~ Bai Juyi



a few days to visit his friend Yuan Zhen, who was also in
exile and with whom he explored the rock caves located at Yichang. ~ Bai Juyi



was
delighted by the flowers and trees for which his new location was noted. In 819,
he was recalled back to the capital, ending his exile.
Return to the capital and a new emperor
In 819, ~ Bai Juyi



was recalled to the capital and given the position of second-class
Assistant Secretary. In 821, China got a new emperor, Muzong. After succeeding
to the throne, Muzong spent his time feasting and heavily drinking, and
neglecting his duties as emperor. Meanwhile, the temporarily subdued regional
military governors (jiedushi) began to challenge the central Tang government,
leading to the new de facto independence of three circuits north of the Yellow
River, which had been previously subdued by Emperor Xianzong. Furthermore,
Muzong's administration was characterized by massive corruption. Again, ~ Bai Juyi,

--- IN CHAPTERS (in Dictionaries, in Quotes, in Chapters)



33

   3 Integral Yoga
   1 Philosophy
   1 Occultism
   1 Christianity


   7 The Mother
   7 Sri Aurobindo
   3 Satprem


   7 The Mothers Agenda
   4 The Synthesis Of Yoga
   3 Sri Aurobindo or the Adventure of Consciousness
   2 Letters On Yoga I


1.03_-_Reading, #Walden, and On The Duty Of Civil Disobedience, #Henry David Thoreau, #Philosophy
  
  Those who have not learned to read the ancient classics in the language in which they were written must have a very imperfect knowledge of the history of the human race; for it is remarkable that no transcript of them has ever been made into any modern tongue, unless our civilization itself may be regarded as such a transcript. Homer has never yet been printed in English, nor schylus, nor Virgil evenworks as refined, as solidly done, and as beautiful almost as the morning itself; for later writers, say what we will of their genius, have rarely, if ever, equalled the elaborate beauty and finish and the lifelong and heroic literary labors of the ancients. They only talk of forgetting them who never knew them. It will be soon enough to forget them when we have the learning and the genius which will enable us to attend to and appreciate them. That age will be rich indeed when those relics which we call Classics, and the still older and more than classic but even less known Scriptures of the nations, shall have still further accumulated, when the Vaticans shall be filled with Vedas and
  Zendavestas and Bibles, with Homers and Dantes and Shakespeares, and all the centuries to come shall have successively deposited their trophies in the forum of the world. By such a pile we may hope to scale heaven at last.

1.05_-_Consciousness, #Sri Aurobindo or the Adventure of Consciousness, #Satprem, #Integral Yoga
  As this inner urge or force takes on a distinct individuality, as it grows as indeed a child grows, the seeker will become aware that it does not move at random, as he had thought at first, but converges at certain points of his being, depending upon his current activity, and is in fact behind each of the centers of consciousness: behind the mental centers when we think, assert a will or express something; behind the vital centers when we feel, suffer or desire; or farther down or farther up. That force actually becomes aware of things; all the centers,
  including the mind, are only its openings on the different levels of universal reality, its instruments of transcription and expression. It is the traveller of the worlds,51 the explorer of the planes of consciousness; it connects our various modes of being together, from waking to sleep to death, when the small outer mind is no longer there to inform or guide us; it pervades the entire range of universal existence and communicates everywhere.
  In other words, we have discovered consciousness. We have isolated what in ordinary man is constantly mixed with other things,

1.07_-_A_Song_of_Longing_for_Tara,_the_Infallible, #How to Free Your Mind - Tara the Liberator, #Thubten Chodron, #unset
  Teaching without comprehension is dangerous, for we can easily lead others
  astray. This is easy to do, because we dont always realize that we dont understand. We may think that because weve read a book or a transcript and understand something at one level, that weve understood it completely.
  Then, to cover up our ignorance when people ask questions we cant

1.07_-_Standards_of_Conduct_and_Spiritual_Freedom, #The Synthesis Of Yoga, #Sri Aurobindo, #Integral Yoga
  
  20:No individual rises to these heights except in intense moments, no society yet created satisfies this ideal. And in the present state of morality and of human development none perhaps can or ought to satisfy it. Nature will not allow it, Nature knows that it should not be. The first reason is that our moral ideals are themselves for the most part ill-evolved, ignorant and arbitrary, mental constructions rather than transcriptions of the eternal truths of the spirit. Authoritative and dogmatic, they assert certain absolute standards in theory, but in practice every existing system of ethics proves either in application unworkable or is in fact a constant coming short of the absolute standard to which the ideal pretends. If our ethical system is a compromise or a makeshift, it gives at once a principle of justification to the further sterilising compromises which society and the individual hasten to make with it. And if it insists on absolute love, justice, right with an uncompromising insistence, it soars above the head of human possibility and is professed with lip homage but ignored in practice. Even it is found that it ignores other elements in humanity which equally insist on survival but refuse to come within the moral formula. For just as the individual law of desire contains within it invaluable elements of the infinite whole which have to be protected against the tyranny of the absorbing social idea, the innate impulses too both of individual and of collective man contain in them invaluable elements which escape the limits of any ethical formula yet discovered and are yet necessary to the fullness and harmony of an eventual divine perfection.
  
  --
  
  27:The higher ethical law is discovered by the individual in his mind and will and psychic sense and then extended to the race. The supreme law also must be discovered by the individual in his spirit. Then only, through a spiritual influence and not by the mental idea, can it be extended to others. A moral law can be imposed as a rule or an ideal on numbers of men who have not attained that level of consciousness or that fineness of mind and will and psychic sense in which it can become a reality to them and a living force. As an ideal it can be revered without any need of practice. As a rule it can be observed in its outsides even if the inner sense is missed altogether. The supramental and spiritual life cannot be mechanised in this way, it cannot be turned into a mental ideal or an external rule. It has its own great lines, but these must be made real, must be the workings of an active Power felt in the individual's consciousness and the transcriptions of an eternal Truth powerful to transform mind, life and body. And because it is thus real, effective, imperative, the generalisation of the supramental consciousness and the spiritual life is the sole force that can lead to individual and collective perfection in earth's highest creatures. Only by our coming into constant touch with the divine Consciousness and its absolute Truth can some form of the conscious Divine, the dynamic Absolute, take up our earth-existence and transform its strife, stumbling, sufferings and falsities into an image of the supreme Light, Power and Ananda.
  

1.09_-_Sleep_and_Death, #Sri Aurobindo or the Adventure of Consciousness, #Satprem, #Integral Yoga
  that mental language is the only language we know, so as we wake up,
  its own transcriptions will tend unconsciously to interfere with and to distort the purity of the experience. Without a knowledgeable guide to unravel this tangle, we must learn to remain as mentally silent as possible upon awakening, and to feel, intuitively, the meaning of these other languages; this occurs fairly rapidly as our consciousness develops and our experiences multiply. At first, it is like a jungle of a Chinese marketplace: everything looks the same. Then, over the months and years, one eventually makes out paths and faces, places and signs, and a more vivid proliferation than on earth.
  But how to remember one's sleep? For most people it is a total blank a link is missing. There are in fact many links, or bridges, as the Mother puts it, as if we were made of a series of countries connected to one another by bridges. Thus, we may easily remember some parts of our being and their travels, while others are forgotten for lack of a bridge to the rest of our consciousness. When crossing this void, or untrained part of the consciousness, we forget (which generally happens to those who fall into "ecstasy," a subject we will return to). Usually, a sufficiently developed person travels through the whole range of planes of consciousness in his or her sleep and goes right to the supreme Light of the Spirit Sat-Chit-Ananda most often unconsciously, but those few minutes are the true sleep, true repose in the absolute relaxation of Joy and Light. Sri Aurobindo used to say that the real purpose of sleep is to return spontaneously to the Source and reimmerse oneself in it. From there we come down slowly through each plane the Mind, Vital, Subtle Physical, and Subconscient (the last one is remembered the most easily) where each part of our being has its own corresponding experiences. There are also many zones within each plane, each with its own particular bridge. The major difficulty is in building the first bridge, the connection with the external waking consciousness. The one and only way to do this is to remain perfectly motionless and silent upon awakening. If we turn over or move, everything vanishes or, rather,
  --
  but after the same thing has reoccurred hundreds of times, he will begin to be on guard; and finally, once he has completely awakened to the fact, he will use this foreknowledge to take protective measures beforehand. For example, we may have a spell of depression that day,
  or go into a rage, or feel a movement of rebellion inside us, or a sexual impulse, etc., or even, to take another example of a seemingly different nature, we may trip on the stairs two or three times and almost fall headlong, or contract a violent fever; then we notice that each of these small, very trivial daytime incidents corresponds exactly to another incident, most often symbolic in nature (symbolic, because it is not the fact itself, but a mental transcription when we wake up in the morning), which we experienced the night before: either we were attacked in a "dream" by an enemy, or we were involved in an unhappy turn of event, or else we saw, sometimes very precisely, all the details surrounding the psychological scene that would take place the next day. It would seem that "someone" is perfectly awake in us and very concerned with helping us identify all the why's and hidden mechanisms of our psychological life, all the reasons for our falls as well as progress. For, conversely, we may have a premonition of all the happy psychological movements that will translate the next day into a progress, an opening of consciousness, a feeling of lightness, an inner widening; we remember that the night before we saw a light, an ascent, or a wall or house crumbling (symbolic of our resistance or the mental constructions that were confining us). We are also very struck by the realization that these premonitions are usually not associated with events we deem important on our physical plane, such as the death of a parent or some worldly achievement (although these premonitions also may occur), but with very trivial details, bearing no external importance, yet always very meaningful for our inner progress. This is a sign of the development of our consciousness.
  
  --
  As our being becomes integrated around the psychic, it thus goes from passive to active sleep, if one may still speak of "sleep," and from a troublesome death to an interesting journey or another form of work. But, depending on the breadth of our consciousness, there are also many degrees in this experience, from a limited action that does not extend beyond the small circle of living or dead acquaintances, or the worlds familiar to us, to the universal action of a few great beings whose psychic has in a sense colonized vast stretches of consciousness, and who protect the world with their silent light.
  Let us conclude these brief generalities, which are at best trail markers for the seeker, with a final observation concerning premonitions. We should again emphasize that having a premonition about something is the sign that this "something" already exists on some plane before taking place here; it does not hang in midair. We are extremely scrupulous and precise regarding physical reality, yet we treat the happenings of nonphysical worlds as if they were incoherent or vague, perhaps because the vagueness is in our own mind. We find through experience, however, that everything is perfectly rational, if not always reasonable: not only does the luminosity intensify as we ascend the scale of consciousness, but time accelerates, covering a wider range of space, as it were, or more distant events (both in the future and in the past), and ultimately we emerge into that motionless Light where everything is. As a consequence, we realize that the fulfillment on earth of our premonitory vision takes place sooner or later in time, depending on the plane of consciousness where the vision has occurred. For example, when we see in the subtle Physical, which borders our world, the earthly transcription is almost immediate, a few hours or a day away; we see an accident, and the next day, it takes place.
  Moreover, the vision is very precise, down to the slightest detail. The higher we rise on the scale of consciousness, the later the fulfillment of the vision and the more universal its scope; the details of realization are less precise, as if the happening itself were unavoidable (provided our vision is sufficiently free of egoism), with a margin of uncertainty 102

1.12_-_Sleep_and_Dreams, #Words Of The Mother III, #The Mother, #Integral Yoga
  
  The first seems to be one of those symbolic transcriptions of the inner condition and action which one so often gets in sleep.
  

1.12_-_The_Superconscient, #Sri Aurobindo or the Adventure of Consciousness, #Satprem, #Integral Yoga
  
  Some seekers may therefore never see beings, but only luminous forces; others will see only beings and never any force; it all depends on their inner disposition, on their form of aspiration, on their religious, spiritual, or even cultural background. This is where subjectivity begins, and with it the possibility of confusion and superstition. But subjectivity should not undermine the experience itself; it is merely a sign that the same thing can be viewed and transcribed differently depending on our nature have two artists ever seen the same landscape in the same way? According to the experts in natural and supernatural phenomena, the criterion for truth should be an unchanging consistency of experience, but this is perhaps more likely a criterion of monotony; the very multiplicity of experiences proves that we are dealing with a living truth, not a wooden substance like our mental or physical truths. Furthermore, these conscious highly conscious forces can take any form at will, not to deceive us but to make themselves accessible to the particular consciousness of the person who opens himself to them or invokes them. A Christian saint having a vision of the Virgin and an Indian having a vision of Durga may see the same thing; they may have entered in contact with the same plane of consciousness, the same forces; yet Durga would obviously mean nothing to the Christian. On the other hand, if this same force manifested itself in its pure state, namely, as a luminous, impersonal vibration, it would be accessible neither to the Virgin worshipper nor to the Durga devotee; it would not speak to their hearts. Devotion, too, has its place, for not everyone has the necessary development to feel the intensity of love contained in a simple little golden light without form. Still more remarkably, if a poet, such as Rimbaud or Shelley, came in contact with these same planes of consciousness, he would see something completely different again, yet still the same thing; obviously, neither Durga nor the Virgin is of particular concern to a poet, so he might perceive instead a great vibration, pulsations of light, or colored waves, which in him would translate into an intense poetic emotion. We may recall Rimbaud: "O happiness, O reason, I drew aside the azure of the sky, which is blackness, and I lived as a golden spark of natural light." This emotional translation may indeed come from the same plane of consciousness, or have the same frequency, we might say, as that of the Indian or Christian mystic, even though the poetic transcription of the vibration seems far removed from any religious belief. The mathematician suddenly discerning a new configuration of the world may have touched the same height of consciousness, the same revelatory vibration. For nothing happens "by chance"; everything comes from somewhere, from a particular plane, and each plane has its own wavelength, its own luminous intensity, its own frequency, and one can enter the same plane of consciousness, the same illumination in a thousand different ways.
  
  --
  
  We speak of "error" because we do not yet see the good it is preparing, or of which it is the visible half; we speak of "falsehood" because we have not yet had enough time to see the lotus blossom out of the mud; we speak of "black," but our daylight is black to one who sees the Light! Our error was the necessary companion of good; no was the inseparable other half of yes; white and black and all the other colors of the rainbow were the various transcriptions of a unique light gradually unveiling itself. There are no opposites, only complements.
  
  --
  
  A poem is not "illumined" because of its meaning; it is illumined because it embodies the particular note of that plane. We could find the same note in a painting by Rembrandt, a musical composition by Csar Franck, or simply in a friend's words; it is the touch of truth behind, the little vibration that goes straight to our heart, for which the poem, the canvas, or the sonata are only more or less adequate transcriptions. The higher one rises, the purer, more luminous, vast, and powerful is the vibration. When Wordsworth says:
  

1.26_-_A_general_estimate_of_the_comparative_worth_of_Epic_Poetry_and_Tragedy., #Poetics, #Aristotle, #Philosophy
  1.F.1. Project Gutenberg volunteers and employees expend considerable effort to identify, do copyright research on, transcribe and proofread public domain works in creating the Project Gutenberg-tm collection. Despite these efforts, Project Gutenberg-tm electronic works, and the medium on which they may be stored, may contain
  "Defects," such as, but not limited to, incomplete, inaccurate or corrupt data, transcription errors, a copyright or other intellectual property infringement, a defective or damaged disk or other medium, a computer virus, or computer codes that damage or cannot be read by your equipment.
  

1.42_-_This_Self_Introversion, #Magick Without Tears, #Aleister Crowley, #Philosophy
  Note:
  The original key-entry also contained a transcription of a handwritten note which was made completely unintelligible by a number of omissions, either of illegible words or of symbols which could not be rendered in ASCII. It ran thusly:
  

2.05_-_The_Cosmic_Illusion;_Mind,_Dream_and_Hallucination, #The Life Divine, #Sri Aurobindo, #Integral Yoga
   souls proceed from birth to birth through the ages: stars and planets may disappear after a lapse of aeons or of many lightcycles, but universe, cosmic existence may well be a permanent as it is certainly a continuous activity; there is nothing to prove that the Infinite Energy which creates it has an end or a beginning either of itself or of its action. So far there is too great a disparateness between dream-life and waking life to make the analogy applicable.
  But it may be questioned whether our dreams are indeed totally unreal and without significance, whether they are not a figure, an image-record or a symbolic transcript or representation of things that are real. For that we have to examine, however summarily, the nature of sleep and of dream phenomena, their process of origination and their provenance. What happens in sleep is that our consciousness withdraws from the field of its waking experiences; it is supposed to be resting, suspended or in abeyance, but that is a superficial view of the matter. What is in abeyance is the waking activities, what is at rest is the surface mind and the normal conscious action of the bodily part of us; but the inner consciousness is not suspended, it enters into new inner activities, only a part of which, a part happening or recorded in something of us that is near to the surface, we remember. There is maintained in sleep, thus near the surface, an obscure subconscious element which is a receptacle or passage for our dream experiences and itself also a dream-builder; but behind it is the depth and mass of the subliminal, the totality of our concealed inner being and consciousness which is of quite another order. Normally it is a subconscient part in us, intermediate between consciousness and pure inconscience, that sends up through this surface layer its formations in the shape of dreams, constructions marked by an apparent inconsequence and incoherence. Many of these are fugitive structures built upon circumstances of our present life selected apparently at random and surrounded with a phantasy of variation; others call back the past, or rather selected circumstances and persons of the past, as a starting-point for similar fleeting edifices. There are other dreams of the subconscious which seem to be pure phantasy
  
  --
   thence we emerge again into the dream-shallows or return to the waking surface.
  But, in fact, in what we call dreamless sleep, we have gone into a profounder and denser layer of the subconscient, a state too involved, too immersed or too obscure, dull and heavy to bring to the surface its structures, and we are dreaming there but unable to grasp or retain in the recording layer of subconscience these more obscure dream figures. Or else, it may be, the part of our mind which still remains active in the sleep of the body has entered into the inner domains of our being, the subliminal mental, the subliminal vital, the subtle-physical, and is there lost to all active connection with the surface parts of us. If we are still in the nearer depths of these regions, the surface subconscient which is our sleep-wakefulness records something of what we experience in these depths; but it records it in its own transcription, often marred by characteristic incoherences and always, even when most coherent, deformed or cast into figures drawn from the world of waking experience. But if we have gone deeper inward, the record fails or cannot be recovered and we have the illusion of dreamlessness; but the activity of the inner dream consciousness continues behind the veil of the now mute and inactive subconscient surface. This continued dream activity is revealed to us when we become more inwardly conscious, for then we get into connection with the heavier and deeper subconscient stratum and can be aware - at the time or by a retracing or recovering through memory - of what happened when we sank into these torpid depths. It is possible too to become conscious deeper within our subliminal selves and we are then aware of experiences on other planes of our being or even in supraphysical worlds to which sleep gives us a right of secret entry. A transcript of such experiences reaches us; but the transcriber here is not the subconscious, it is the subliminal, a greater dream-builder.
  If the subliminal thus comes to the front in our dream consciousness, there is sometimes an activity of our subliminal intelligence, - dream becomes a series of thoughts, often strangely or vividly figured, problems are solved which our
  --
  Sleep like trance opens the gate of the subliminal to us; for in sleep, as in trance, we retire behind the veil of the limited waking personality and it is behind this veil that the subliminal has its existence. But we receive the records of our sleep experience through dream and in dream figures and not in that condition which might be called an inner waking and which is the most accessible form of the trance state, nor through the supernormal clarities of vision and other more luminous and concrete ways of communication developed by the inner subliminal cognition when it gets into habitual or occasional conscious connection with our waking self. The subliminal, with the subconscious as an annexe of itself, - for the subconscious is also part of the behind-the-veil entity, - is the seer of inner things and of supraphysical experiences; the surface subconscious is only a transcriber. It is for this reason that the Upanishad describes the subliminal being as the Dream Self because it is normally in dreams, visions, absorbed states of inner experience that we enter into and are part of its experiences, - just as it describes the superconscient as the Sleep Self because normally all mental or sensory experiences cease when we enter this superconscience.
  For in the deeper trance into which the touch of the superconscient plunges our mentality, no record from it or transcript of its contents can normally reach us; it is only by an especial or an unusual development, in a supernormal condition or through a break or rift in our confined normality, that we can be on the surface conscious of the contacts or messages of the Superconscience. But, in spite of these figurative names of dream-state and sleep-state, the field of both these states of consciousness was clearly regarded as a field of reality no less than that of the waking state in which our movements of perceptive
  
  --
  The Life Divine
   consciousness are a record or transcript of physical things and of our contacts with the physical universe. No doubt, all the three states can be classed as parts of an illusion, our experiences of them can be ranked together as constructions of an illusory consciousness, our waking state no less illusory than our dream state or sleep state, since the only true truth or real reality is the incommunicable Self or One-Existence (Atman, Adwaita) which is the fourth state of the Self described by the Vedanta. But it is equally possible to regard and rank them together as three different orders of one Reality or as three states of consciousness in which is embodied our contact with three different grades of self-experience and world-experience.
  If this is a true account of dream experience, dreams can no longer be classed as a mere unreal figure of unreal things temporarily imposed upon our half-unconsciousness as a reality; the analogy therefore fails even as an illustrative support for the theory of the cosmic Illusion. It may be said, however, that our dreams are not themselves realities but only a transcript of reality, a system of symbol-images, and our waking experience of the universe is similarly not a reality but only a transcript of reality, a series or collection of symbol-images. It is quite true that primarily we see the physical universe only through a system of images impressed or imposed on our senses and so far the contention is justified; it may also be admitted that in a certain sense and from one view-point our experiences and activities can be considered as symbols of a truth which our lives are trying to express but at present only with a partial success and an imperfect coherence. If that were all, life might be described as a dream-experience of self and things in the consciousness of the Infinite. But although our primary evidence of the objects of the universe consists of a structure of sense images, these are completed, validated, set in order by an automatic intuition in the consciousness which immediately relates the image with the thing imaged and gets the tangible experience of the object, so that we are not merely regarding or reading a translation or sense-transcript of the reality but looking through the senseimage to the reality. This adequacy is amplified too by the action
  
  --
  445
   of a reason which fathoms and understands the law of things sensed and can observe scrupulously the sense-transcript and correct its errors. Therefore we may conclude that we experience a real universe through our imaged sense-transcript by the aid of the intuition and the reason, - an intuition which gives us the touch of things and a reason which investigates their truth by its conceptive knowledge. But we must note also that even if our image view of the universe, our sense-transcript, is a system of symbol images and not an exact reproduction or transcription, a literal translation, still a symbol is a notation of something that is, a transcript of realities. Even if our images are incorrect, what they endeavour to image are realities, not illusions; when we see a tree or a stone or an animal, it is not a non-existent figure, a hallucination that we are seeing; we may not be sure that the image is exact, we may concede that other-sense might very well see it otherwise, but still there is something there that justifies the image, something with which it has more or less correspondence. But in the theory of Illusion the only reality is an indeterminable featureless pure Existence, Brahman, and there is no possibility of its being translated or mistranslated into a system of symbol-figures, for that could only be if this Existence had some determinate contents or some unmanifested truths of its being which could be transcribed into the forms or names given to them by our consciousness: a pure Indeterminable cannot be rendered by a transcript, a multitude of representative differentiae, a crowd of symbols or images; for there is in it only a pure Identity, there is nothing to transcribe, nothing to symbolise, nothing to image. Therefore the dream analogy fails us altogether and is better put out of the way; it can always be used as a vivid metaphor of a certain attitude our mind can take towards its experiences, but it has no value for a metaphysical inquiry into the reality and fundamental significances or the origin of existence.
  If we take up the analogy of hallucination, we find it hardly more helpful for a true understanding of the theory of cosmic

2.2.03_-_The_Science_of_Consciousness, #Essays Divine And Human, #Sri Aurobindo, #Integral Yoga
  
  Around us is a universal Mind of which our mind is a formation and our thoughts, feelings, will, impulses are continually little more than a personally modified reception and transcription of its thought-waves, its force-currents, its foam of emotion and sensation, its billows of impulse.
  

2.3.01_-_The_Planes_or_Worlds_of_Consciousness, #Letters On Yoga I, #Sri Aurobindo, #Integral Yoga
  
  Even when we are awake, part of us moves in these planes, but their activity goes on behind the veil; our waking minds are not aware of it. Dreams are often only incoherent constructions of our subconscient, but others are records (often much mixed and distorted) or transcripts of experiences in these supraphysical
  

4.0_-_NOTES_TO_ZARATHUSTRA, #Twilight of the Idols, #Friedrich Nietzsche, #Philosophy
  "Defects," such as, but not limited to, incomplete, inaccurate or
  corrupt data, transcription errors, a copyright or other intellectual
  property infringement, a defective or damaged disk or other medium, a

4.1.01_-_The_Intellect_and_Yoga, #Letters On Yoga I, #Sri Aurobindo, #Integral Yoga
  
  The Tantriks have a phrase pasyant vak to describe one level of the Vak-Shakti, the seeing Word; here is pasyant buddhi, a seeing Intelligence. It might be because the seer within has passed beyond thought into experience, but there are many who have a considerable wealth of experience without its clarifying their eye of thought to this extent; the soul feels, but the mind goes on with mixed and imperfect transcriptions, blurs and confusions in the idea. There must have been the gift of right vision lying ready in this nature.
  

4.11_-_The_Perfection_of_Equality, #The Synthesis Of Yoga, #Sri Aurobindo, #Integral Yoga
  
  The Master of things cannot be affected or troubled by the reactions of things; if he were, he would be subject to them, not master, not free to develop them according to his sovereign will and wisdom and according to the inner truth and necessity of what is behind their relations, but obliged rather to act according to the claim of temporary accident and phenomenon. The truth of all things is in the calm of their depths, not in the shifting inconstant wave form on the surface. The supreme conscious Being in his divine knowledge and will and love governs their evolution -- to our ignorance so often a cruel confusion and distraction -- from these depths and is not troubled by the clamour of the surface. The divine nature does not share in our gropings and our passions; when we speak of the divine wrath or favour or of God suffering in man, we are using a human language which mistranslates the inner significance of the movement we characterise. We see something of the real truth of them when we rise out of the phenomenal mind into the heights of the spiritual being. For then we perceive that whether in the silence of self or in its action in the cosmos, the Divine is always Sachchidananda, an infinite existence, an infinite consciousness and self-founded power of conscious being, an infinite bliss in all his existence. We ourselves begin to dwell in an equal light, strength, joy-the psychological rendering of the divine knowledge, will and delight in self and things which are the active universal outpourings from those infinite sources. In the strength of that light, power and joy a secret self and spirit within us accepts and transforms always into food of its perfect experience the dual letters of the mind's transcript of life, and if there were not the hidden greater existence even now within us, we could not bear the pressure of the universal force or subsist in this great and dangerous world. A perfect equality of our spirit and nature is a means by which we can move back from the troubled and ignorant outer consciousness into this inner kingdom of heaven and possess the spirit's eternal kingdoms, rajyam samrddham, of greatness, joy and peace. That self-elevation to the divine nature is the complete fruit and the whole occasion of the discipline of equality demanded from us by the self-perfecting aim in Yoga.
  

4.24_-_The_supramental_Sense, #The Synthesis Of Yoga, #Sri Aurobindo, #Integral Yoga
  
  The range of the psychic consciousness and its experiences is almost illimitable and the variety and complexity of its phenomena almost infinite. Only some of the broad lines and main features can be noted here. The first and most prominent is the activity of the psychic senses of which the sight is the most developed ordinarily arid the first to manifest itself with ally largeness when the veil of the absorption in the surface consciousness which prevents the inner vision is broken. But all the physical senses have their corresponding powers in the psychical being, there is a psychical hearing, touch, smell, taste: indeed the physical senses are themselves in reality only a projection of the inner sense into limited and externalised operation in and through and upon the phenomena of gross matter. The psychical sight receives characteristically the images that are formed in the subtle matter of the mental or psychical ether, cittakasa. These may be transcriptions there or impresses of physical things, persons, scenes, happenings, whatever is, was or will be or may be in the physical universe. These images are very variously seen and under all kinds of conditions; in Samadhi or in the waking state, and in the latter with the bodily eyes closed or open, projected on or into a physical object or medium or seen as if materialised in the physical atmosphere or only in a psychical ether revealing itself through this grosser physical atmosphere; seen through the physical eyes themselves as a secondary instrument and as if under the conditions of the physical vision or by the psychical vision alone and independently of the relations of our ordinary sight to space. The real agent is always the psychical sight and the power indicates that the consciousness is more or less awake, intermittently or normally and more or less perfectly, in the psychical body. It is possible to see in this way the transcriptions or impressions of things at any distance beyond the range of the physical vision or the images of the past or the future.
  
  Besides these transcriptions or impresses the psychical vision receives thought images and other forms created by constant activity of consciousness in ourselves or in other human beings, and these may be according to the character of the activity images of truth or falsehood or else mixed things, partly true, partly false, and may be too either mere shells and representations or images inspired with a temporary life and consciousness and, it may be, carrying in them in one way or another some kind of beneficent or maleficent action or some willed or unwilled effectiveness on our minds or vital being or through them even on the body. These transcriptions, impresses, thought images, life images, projections of the consciousness may also be representations or creations not of the physical world, but of vital, psychic or mental worlds beyond us, seen in our own minds or projected from other than human beings. And as there is this psychical vision of which some of the more external and ordinary manifestations are well enough known by the name of clairvoyance, so there is a psychical hearing and psychical touch, taste, smell, -- clairaudience, clairsentience are the more external manifestations, -- with precisely the same range each in its own kind, the same fields and manner and conditions and varieties of their phenomena.
  
  --
  
  For there is a continuous scale of the planes of consciousness, beginning with the psychical and other belts attached to and dependent on the earth plane and proceeding through the true independent vital and psychical worlds to the worlds of the gods and the highest supramental and spiritual planes of existence. And these are in fact always acting upon our subliminal selves unknown to our waking mind and with considerable effect on our life and nature. The physical mind is only a little part of us and there is a much more considerable range of our being in which the presence, influence and powers of the other planes are active upon us and help to shape our external being and its activities. The awakening of the psychical consciousness enables us to become aware of these powers, presences and influences in and around us; and while in the impure or yet ignorant and imperfect mind this unveiled contact has its dangers, it enables us too, if rightly used and directed, to be no longer their subject but their master and to come into conscious and self-controlled possession of the inner secrets of our nature. The psychical consciousness reveals this interaction between the inner and the outer planes, this world and others, partly by an awareness, which may be very constant, vast and vivid, of their impacts, suggestions, communications to our inner thought and conscious being and a capacity of reaction upon them there, partly also through many kinds of symbolic, transcriptive or representative images presented to the different psychical senses. But also there is the possibility of a more direct, concretely sensible, almost material, sometimes actively material communication -- a complete though temporary physical materialisation seems to be possible-with the powers, forces and beings of other worlds and planes. There may even be a complete breaking of the limits of the physical consciousness and the material existence.
  
  --
  
  All the experiences of the psychical are accepted and held up indeed in the supramental consciousness and its energy, but they are filled with the light of a greater truth, the substance of a greater spirit. The psychical consciousness is first supported and enlightened, then filled and occupied with the supramental light and power and the revealing intensity of its vibrations. Whatever exaggeration, whatever error born of isolated incidence, insufficiently illumined impression, personal suggestion, misleading influence and intention or other cause of limitation or deformation interferes in the truth of the mental and psychical experience and knowledge, is revealed and cured or vanishes, failing to stand in the light of the self-truth -- satyam, rtam -- of things, persons, happenings, indications, representations proper to this greater largeness. All the psychical communications, transcriptions, impresses, symbols, images receive their true value, take their right place, are put into their proper relations. The psychical intelligence and sensation are lit up with the supramental sense and knowledge, their phenomena, intermediate between the spiritual and material worlds, begin to reveal automatically their own truth and meaning and also the limitations of their truth and significance. .The images presented to the inner sight, hearing, sensation of all kinds are occupied by or held in a larger and more luminous mass of vibrations, a greater substance of light and intensity which brings into them the same change as in the things of the physical sense, a greater totality, precision, revealing force of sense knowledge carried in the image. And finally all is lifted up and taken into the supermind and made a part of the infinitely luminous consciousness, knowledge and experience of the supramental being, the Vijnana Purusha.
  

4.25_-_Towards_the_supramental_Time_Vision, #The Synthesis Of Yoga, #Sri Aurobindo, #Integral Yoga
  
  The true and direct knowledge or vision of past, present and future begins with the opening of the psychical consciousness and the psychical faculties. The psychical consciousness is that of what is now often called the subliminal self, the subtle or dream self of Indian psychology, and its range of potential knowledge, almost infinite as has been pointed out in the last chapter, includes a very large power and many forms of insight into both the possibilities and the definite actualities of past, present and future. Its first faculty, that which most readily attracts attention, is its power of seeing by the psychical sense images of all things in time and space. As exercised by clairvoyants, mediums and others this is often, and indeed usually, a specialised faculty limited though often precise and accurate in action, and implies no development of the inner soul or the spiritual being or the higher intelligence. It is a door opened by chance or by an innate gift or by some kind of pressure between the waking and the subliminal mind and admitting only to the surface or the outskirts of the latter. All things in a certain power and action of the secret universal mind are represented by images, -- not only visual but, if one may use the phrase, auditory and other images, -- and a certain development of the subtle or psychical senses makes it possible, -- if there is no interference of the constructing mind and its imaginations, if, that is to say, artificial or falsifying mental images do not intervene, if the psychical sense is free, sincere and passive, --to receive these representations or transcriptions with a perfect accuracy and not so much predict as see in its correct images the present beyond the range of the physical sense, the past and the future. The accuracy of this kind of seeing depends on its being confined to a statement of the thing seen and the attempt to infer, interpret or otherwise go beyond the visual knowledge may lead to much error unless there is at the same time a strong psychical intuition fine, subtle and pure or a high development of the luminous intuitive intelligence.
  
  A completer opening of the psychical consciousness leads us far beyond this faculty of vision by images and admits us not indeed to a new time consciousness, but to many ways of the triple time knowledge. The subliminal or psychic self can bring back or project itself into past states of consciousness and experience and anticipate or even, though this is less common, strongly project itself into future states of consciousness and experience. It does this by a temporary entering into or identification of its being or its power of experiencing knowledge with either permanences or representations of the past and the future that are maintained in an eternal time consciousness behind our mentality or thrown up by the eternity of supermind into an indivisible continuity of time vision. Or it may receive the impress of these things and construct a transcriptive experience of them in the subtle ether of psychical being. Or it may call up the past from the subconscious memory where it is always latent and give it in itself a living form and a kind of renewed memorative existence, and equally it may call up from the depths of latency, where it is already shaped in the being, and similarly form to itself and experience the future. It may by a kind of psychical thought vision or soul intuition -- not the same thing as the subtler and less concrete thought vision of the luminous intuitive intelligence -- foresee or foreknow the future or flash this soul intuition into the past that has gone behind the veil and recover it for present knowledge. It can develop a symbolic seeing which conveys the past and the future through a vision of the powers and significances that belong to supraphysical planes but are powerful for creation in the material universe. It can feel the intention of the Divine, the mind of the gods, all things and their signs and indices that descend upon the soul and determine the complex movement of forces. It can feel too the movement of forces that represent or respond to the pressure -- as it can perceive the presence and tile action -- of the beings of the mental, vital and other worlds who concern themselves with our lives. It can gather on all hands all kinds of indications of happenings in past, present and future time. It can receive before its sight the etheric writing, akasa-lipi, that keeps the record of all things past, transcribes all that is in process in the present, writes out the future.
  

Agenda_Vol_10, #The Mothers Agenda, #The Mother, #Integral Yoga
  took place, but very clearly and precisely; while to others I spoke of this experience, and they
  transcribed it: two transcriptions were read out to me, very different from each other (while I very
  nearly said the same thing), each transcription is different, and there is a slight distortion, different too,
  in each.

Agenda_Vol_2, #The Mothers Agenda, #The Mother, #Integral Yoga
  Bliss, synonymous with Love). But according to Theon, there were four (I knew them by heart). Well,
  190See the addendum following this conversation for a transcription of Mother's vision as she noted it down for publication
  in Theon's Cosmic Review in 1906.
  --
  243According to Mother's wishes, the tape was erased up to this point. But years passed and circumstances changed, and
  when Satprem found the transcription of this conversation among his papers, he deemed it worthwhile to preserve the major
  portion of it for its historical interest. Mother's difficulties are always the difficulties of the 'Terrestrial Work'; and this

Agenda_Vol_3, #The Mothers Agenda, #The Mother, #Integral Yoga
  spiritual will (it's what happens to all who feel themselves guided by the Divine within), but it still
  comes through a mental transcription. Well, as long as it's that way, it's not the supramental life. The
  supramental life NO LONGER goes through the mind - the mind is an immobile zone of transmission.
  --
  are self-existent and can be seen in the subtle physical - they already exist there, and the reflection (not
  even transcription) or projection of this image is what will take place in the material world the next day
  or a few hours later. In this case you see the thing accurately, in all its details, because it's already there.
  --
  recapture it. The other world, the three-dimensional world, is completely unreal; but now that one...
  (what can I say?) seems conventional to me. Like a conventional transcription opening a particular type
  of approach to you.
  --
  was no longer the same. It was absolutely wonderful, it explained... not that it explained everything, but
  it was a revelation. There must have been some fault in the transcription. It all came back after you left.
  I looked and asked myself, "Why did I say it was so marvelous!" And I understood: when I saw it, I
  --
  And they were the very words, the exact words - but those words... something else was in them.
  Perhaps it's the transcription.... And yet, they were those very words.
  It's most interesting.
  --
  I had a dream about you, but I felt the subconscient made it up.
  No, it must be a transcription.
  A strange dream, very strange. A crowd of people was waiting for you to come out, and you did

Agenda_Vol_4, #The Mothers Agenda, #The Mother, #Integral Yoga
  and a sense of security and certainty not to be found in physical life. And the symbolism is more exact
  (I don't know how to express it...), the symbolic transcription of things is less distorted, more exact.
  This is the subtle physical as I know it, I can't say if it is the same for everyone. Sri Aurobindo said,
  --
  asked Satprem to erase the recording, except for a few fragments, but he thought it fit to retain at least
  its integral transcription.)
  Here, your flowers [roses]. A magnificent color....
  --
  
  that food coming from the whole Nature at once - it's a seemingly silly transcription, but anyway...),
  you will bring it in this translucent bowl. And I replied, Yes, I knew, I knew that I had to use this
  --
  was still too strong and powerful for the material brain. And I saw it immediately; at the very moment
  of the experience, I saw it was a transcription, and an extraordinarily poor transcription, but nothing
  better could be done.
  --
  It's a minimum of distortion. I am forever studying, in the body, the difference between THE Thing
  and its transcription. It's very interesting. Very subtle - very subtle. And it takes a mere nothing for it
  not to be the True Thing any more.

Agenda_Vol_5, #The Mothers Agenda, #The Mother, #Integral Yoga
  always takes the form of an experience, an ACTION: something that has to be done and gets done, or
  that has to be known and becomes known. It is never the mental transcription of ordinary life.
  The Pope... I wonder why: what happened? What does it mean? Why did it happen? But I still see
  --
  the impression of something hard, rather inert, very artificial, extremely thin, dry, with just an artificial
  transcription of life - and that was the ordinary consciousness, the consciousness that makes you feel
  you are in a body.
  --
  unforeseen beyond all that we can imagine: disjointed, no logic, no sense, nothing. It SOUNDS like
  43It is the transcription, by W. Landowska, of a "popular Polish song."
  44It was electronic music.
  --
  [during Satprem's trip to France], because I had the feeling that if certain things went away, it might be
  a pity. I tried with Nolini and Pavitra: nothing comes out, except a sort of mental transcription.
  When I called you Satprem, that's what I meant: you must certainly have the capacity to come into
  --
  During your lifetime, during the lifetime of the one who works, you would have to create a body,
  67The transcription of this first sentence is quite uncertain.
  
  --
  One has a feeling that it doesn't depend so much on that as on the fact that the world or
  circumstances aren't ready, and that when circumstances are ready, maybe it won't be a "long68The transcription of this last sentence is uncertain.
  

Agenda_Vol_8, #The Mothers Agenda, #The Mother, #Integral Yoga
  What about you?
  You know, I have the impression, exactly an impression (it's a transcription), the impression of being
  on the verge of finding a key - a key or a "trick"... a procedure (I don't know how to put it: all this is
  --
  telegram from a young boy he adopted and is very fond of: he had sent a telegram to let me know that
  the doctors had all but condemned him.) Then he had that experience - it's a transcription, of course,
  according to his conception. But it's interesting.
  --
  
  memories, but when I speak I don't remember the sounds I utter, there is only the mental transcription.
  I don't have the memory of sounds.
  --
  never achieve anything in life!" (Mother laughs)
  And it was really the childlike transcription of the need for ever more, ever better, ever more, ever
  better... endlessly - the sense of advance, advance towards perfection. A perfection that I felt to be
  --
  It came in two ways. Those things are SEEN, you understand, seen. Words come afterwards to try
  97See conversation of June 21, 1967. This was not a note by Mother, but the rough transcription noted by a disciple, which
  was published outright as being Mother's words.
  --
  her fingers) just slightly off, that is, not identically what I saw. And when they tell me, I clearly feel it's
  because of, yes, the transcription in their brains.... The objective reality of the material world stems
  from the fact that when you see the same object again ten times, it looks ten times like itself, with
  --
  may have visions in the subtle physical, in the vital, also a lot in the mind, but... none of that is
  satisfying, one always gets a sense of a not quite accurate transcription.) But the true vision is the
  vision of the Consciousness, the supreme Consciousness. And he told me that's what you would have.
  --
  I also worry a lot over this book, this "Sannyasin" I am rewriting.... That difficulty of a PURE
  transcription.
  (After a long silence) As for me, I have always felt that writing was your way of doing the sadhana.

Agenda_Vol_9, #The Mothers Agenda, #The Mother, #Integral Yoga
  "language," but a way of being), it's Kali that wants to strike, and I have to tell her, "Keep still, keep
  still." But that's a human transcription. All those gods, all those beings are real, they exist, but... it's a
  transcription. True truth is beyond all that.
  
  --
  and words don't frighten her. But I sent him my permission: I had it explained to him that words were
  just a more or less clumsy transcription not only of the idea, but of what is above the idea - the
  principle; that it didn't matter much whether these or those words were used (each one uses the words
  --
  clumsy that disappears.
  It's the same thing in the transcription (pointing to the note). When it comes down, there is a will to
  write, and somewhere there, something might have said as I told you: "But it's a condensation of the
  --
  acting, which is a sort of... (words are stupid), a "psychic benevolence," which is an expression of
  divine Oneness (Mother shakes her head at the inadequacy of words). The mental transcription takes
  all the truth out of it.
  --
  How far away I was when I spoke like that [the 1953 talk]! How far away I was.... It was a mental
  transcription. Well, it doesn't matter; it amuses people. They understand that; what I may do now, they
  don't understand. And then...

BS_1_-_Introduction_to_the_Idea_of_God, #unset, #Sri Aurobindo, #Integral Yoga
  
  class:transcript
  class:Biblical Series

class, #unset, #Sri Aurobindo, #Integral Yoga
     8 Words Of The Mother III
     8 transcript
     8 theory

COSA_-_BOOK_XIII, #The Confessions of Saint Augustine, #Saint Augustine of Hippo, #Christianity
  "Defects," such as, but not limited to, incomplete, inaccurate or
  corrupt data, transcription errors, a copyright or other intellectual
  property infringement, a defective or damaged disk or other medium, a

Evening_Talks_With_Sri_Aurobindo, #Talks With Sri Aurobindo, #Sri Aurobindo, #Integral Yoga
  
  Sri Aurobindo: Dreams have nothing to do with the brain. A dream is merely a confused transcript in sleep of something that happens behind. The thing gets confused because the controlling mind is not there. All sorts of things rush up from the passive memory, events of the day, impressions of the mind. If the mind remains conscious in dreams, you can know the working that takes place behind. Some dreams correctly represent what is taking place behind such dreams are clear and cogent.
  

Talks_With_Sri_Aurobindo_1, #unset, #Sri Aurobindo, #Integral Yoga
  NIRODBARAN: So also poets can transmit or transcribe creative force without
  being conscious of it, and I suppose all fine poems are transcriptions.
  SRI AUROBINDO: Yes, poets can do that, but people who have the creative

The_Act_of_Creation_text, #The Act of Creation, #Arthur Koestler, #Psychology
  
  The varied sources of his work and its worthlessness as a transcript
  of actual Celtic poems do not alter the fact that he produced a work

The_Golden_Bough, #unset, #Sri Aurobindo, #Integral Yoga
  things, Defects may take the form of incomplete, inaccurate or
  corrupt data, transcription errors, a copyright or other
  intellectual property infringement, a defective or damaged

The_Immortal, #unset, #Sri Aurobindo, #Integral Yoga
  In the last volume of the Iliad she found this manuscript.
  It is written in an English that teems with Latinisms; this is a verbatim transcription of the document.
  I
  --
  Its patent antiquity (though somehow terrible to the eyes) seemed to accord with the labor of immortal artificers. Cautiously at first, with indifference as time went on, desperately toward the end, I wandered the staircases and inlaid floors of that labyrinthine palace. (I discovered afterward that the width and height of the treads on the staircases were not constant; it was this that explained the extraordinary weariness I felt.) This palace is the work of the gods, was my first thought. I explored the uninhabited spaces, and I corrected myself: The gods that built this place have died. Then I reflected upon its peculiarities, and told myself: The gods that built this place were mad. I said this, I know, in a tone of incomprehensible reproof that verged upon remorse - with more intellectual horror than sensory fear.
  The impression of great antiquity was joined by others: the impression of endlessness, the sensation of oppressiveness and horror, the sensation of complex irrationality. I had made my way through a dark maze, but it was the bright City of the Immortals that terrified and repelled me. A maze is a house built purposely to confuse men; its architecture, prodigal in symmetries, is made to serve that purpose. In the palace that I imperfectly explored, the architecture had no purpose. There were corridors that led nowhere, unreachably high windows, grandly dramatic doors that opened onto monklike cells or empty shafts, incredible upside-down staircases with upside-down treads and balustrades. Other staircases, clinging airily to the side of a monumental wall, petered out after two or three landings, in the high gloom of the cupolas, arriving nowhere. I cannot say whether these are literal examples I have given; I do know that for many years they plagued my troubled dreams; I can no longer know whether any given feature is a faithful transcription of reality or one of the shapes unleashed by my nights. This City, I thought, is so horrific that its mere existence, the mere fact of its having endured - even in the middle of a secret desert - pollutes the past and the future and somehow compromises the stars. So long as this City endures, no one in the world can ever be happy or courageous. I do not want to describe it; a chaos of heterogeneous words, the body of a tiger or a bull pullulating with teeth, organs, and heads monstrously yoked together yet hating each other - those might, perhaps, be approximate images.
  I cannot recall the stages by which I returned, nor my path through the dusty, humid crypts. I know only that I was accompanied by the constant fear that when I emerged from the last labyrinth I would be surrounded once again by the abominable City of the Immortals. I remember nothing else. That loss of memory, now insurmountable, was perhaps willful; it is possible that the circumstances of my escape were so unpleasant that on some day no less lost to memory I swore to put them out of my mind.

The_Riddle_of_this_World, #unknown, #Sri Aurobindo, #Integral Yoga
  experience is individual, coloured by the individuality of the seer. It may
  be true to a certain extent of the precise form or transcription given to
  
  --
  soul feels, but the mind goes on with mixed and imperfect
  transcriptions, blurs and confusions in the idea. There must have been
  the gift of right vision lying ready in this nature.

change font "color":
change "background-color":
change "font-family": 48007 site hits