TOPICS

SEE ALSO

network

the_Matrix

Westworld

AUTH

BOOKS

Infinite_Library

IN CHAPTERS TITLE

IN CHAPTERS CLASSNAME

IN CHAPTERS TEXT

0_1972-04-26

0_1972-12-06

1.01_-_Economy

1.18_-_The_Perils_of_the_Soul

1f.lovecraft_-_At_the_Mountains_of_Madness

1f.lovecraft_-_The_Mound

1f.lovecraft_-_The_Whisperer_in_Darkness

2.24_-_The_Evolution_of_the_Spiritual_Man

3.08_-_Of_Equilibrium

Aeneid

The_Pilgrims_Progress

PRIMARY CLASS

Computer_Science

programming

subject

SIMILAR TITLES

Hacking

TERMS STARTING WITH

Hacking X for Y ::: [ITS] Ritual phrasing of part of the information which ITS made publicly available about each user. This information (the INQUIR record) was a sort of became traditional and has since been carried over to other systems with more general facilities for self-advertisement (such as Unix plan files).[Jargon File]

Hacking X for Y [ITS] Ritual phrasing of part of the information which ITS made publicly available about each user. This information (the INQUIR record) was a sort of form in which the user could fill out various fields. On display, two of these fields were always combined into a project description of the form "Hacking X for Y" (e.g. ""Hacking perceptrons for Minsky""). This form of description became traditional and has since been carried over to other systems with more general facilities for self-advertisement (such as Unix {plan files}). [{Jargon File}]

hacking ::: p. pr. & vb. n. --> of Hack

hacking run "jargon" (Analogy with "bombing run" or "speed run") A hack session extended long outside normal working times, especially one longer than 12 hours. May cause you to "change {phase} the hard way". [{Jargon File}] (1996-08-26)

hacking run ::: (jargon) (Analogy with bombing run or speed run) A hack session extended long outside normal working times, especially one longer than 12 hours. May cause you to change phase the hard way.[Jargon File] (1996-08-26)


TERMS ANYWHERE

AI koan ::: (humour) /A-I koh'an/ One of a series of pastiches of Zen teaching riddles created by Danny Hillis at the MIT AI Lab around various major figures of the Lab's culture.See also ha ha only serious, mu.In reading these, it is at least useful to know that Marvin Minsky, Gerald Sussman, and Drescher are AI researchers of note, that Tom Knight was one of the Lisp machine's principal designers, and that David Moon wrote much of Lisp Machine Lisp. * * * A novice was trying to fix a broken Lisp machine by turning the power off and on.Knight, seeing what the student was doing, spoke sternly: You cannot fix a machine by just power-cycling it with no understanding of what is going wrong.Knight turned the machine off and on.The machine worked. * * * better garbage collector. We must keep a reference count of the pointers to each cons.Moon patiently told the student the following story: One day a student came to Moon and said: `I understandhow to make a better garbage collector... [Pure reference-count garbage collectors have problems with circular structures that point to themselves.] * * * In the days when Sussman was a novice, Minsky once came to him as he sat hacking at the PDP-6.What are you doing?, asked Minsky.I am training a randomly wired neural net to play Tic-Tac-Toe, Sussman replied.Why is the net wired randomly?, asked Minsky.I do not want it to have any preconceptions of how to play, Sussman said.Minsky then shut his eyes.Why do you close your eyes?, Sussman asked his teacher.So that the room will be empty.At that moment, Sussman was enlightened. * * * A disciple of another sect once came to Drescher as he was eating his morning meal.I would like to give you this personality test, said the outsider, because I want you to be happy.Drescher took the paper that was offered him and put it into the toaster, saying: I wish the toaster to be happy, too. (1995-02-08)

AI koan "humour" /A-I koh'an/ One of a series of pastiches of Zen teaching riddles created by {Danny Hillis} at the {MIT AI Lab} around various major figures of the Lab's culture. See also {ha ha only serious}, {mu}. In reading these, it is at least useful to know that {Marvin Minsky}, {Gerald Sussman}, and Drescher are {AI} researchers of note, that {Tom Knight} was one of the {Lisp machine}'s principal designers, and that {David Moon} wrote much of Lisp Machine Lisp. * * * A novice was trying to fix a broken Lisp machine by turning the power off and on. Knight, seeing what the student was doing, spoke sternly: "You cannot fix a machine by just power-cycling it with no understanding of what is going wrong." Knight turned the machine off and on. The machine worked. * * * One day a student came to Moon and said: "I understand how to make a better garbage collector. We must keep a reference count of the pointers to each cons." Moon patiently told the student the following story:   "One day a student came to Moon and said: `I understand   how to make a better garbage collector... [Pure reference-count garbage collectors have problems with circular structures that point to themselves.] * * * In the days when Sussman was a novice, Minsky once came to him as he sat hacking at the PDP-6. "What are you doing?", asked Minsky. "I am training a randomly wired neural net to play Tic-Tac-Toe", Sussman replied. "Why is the net wired randomly?", asked Minsky. "I do not want it to have any preconceptions of how to play", Sussman said. Minsky then shut his eyes. "Why do you close your eyes?", Sussman asked his teacher. "So that the room will be empty." At that moment, Sussman was enlightened. * * * A disciple of another sect once came to Drescher as he was eating his morning meal. "I would like to give you this personality test", said the outsider, "because I want you to be happy." Drescher took the paper that was offered him and put it into the toaster, saying: "I wish the toaster to be happy, too." (1995-02-08)

bare metal ::: 1. New computer hardware, unadorned with such snares and delusions as an operating system, an HLL, or even assembler. Commonly used in the phrase assemblers that will be used to write the compiler back ends that will give the new computer a real development environment.2. Programming on the bare metal is also used to describe a style of hand-hacking that relies on bit-level peculiarities of a particular hardware industrial embedded systems, and in the code of hackers who just can't let go of that low-level control. See Real Programmer.In the world of personal computing, bare metal programming is often considered a Good Thing, or at least a necessary evil (because these computers have often down to the bare metal. People who can do this sort of thing well are held in high regard.[Jargon File]

bare metal 1. New computer hardware, unadorned with such snares and delusions as an {operating system}, an {HLL}, or even {assembler}. Commonly used in the phrase "programming on the bare metal", which refers to the arduous work of {bit bashing} needed to create these basic tools for a new computer. Real bare-metal programming involves things like building {boot PROMs} and {BIOS} chips, implementing basic {monitors} used to test {device drivers}, and writing the assemblers that will be used to write the compiler back ends that will give the new computer a real development environment. 2. "Programming on the bare metal" is also used to describe a style of {hand-hacking} that relies on bit-level peculiarities of a particular hardware design, especially tricks for speed and space optimisation that rely on crocks such as overlapping instructions (or, as in the famous case described in {The Story of Mel}, interleaving of opcodes on a magnetic drum to minimise fetch delays due to the device's rotational latency). This sort of thing has become less common as the relative costs of programming time and computer resources have changed, but is still found in heavily constrained environments such as industrial embedded systems, and in the code of hackers who just can't let go of that low-level control. See {Real Programmer}. In the world of personal computing, bare metal programming is often considered a {Good Thing}, or at least a necessary evil (because these computers have often been sufficiently slow and poorly designed to make it necessary; see {ill-behaved}). There, the term usually refers to bypassing the BIOS or OS interface and writing the application to directly access device registers and computer addresses. "To get 19.2 kilobaud on the serial port, you need to get down to the bare metal." People who can do this sort of thing well are held in high regard. [{Jargon File}]

Hacking X for Y ::: [ITS] Ritual phrasing of part of the information which ITS made publicly available about each user. This information (the INQUIR record) was a sort of became traditional and has since been carried over to other systems with more general facilities for self-advertisement (such as Unix plan files).[Jargon File]

Hacking X for Y [ITS] Ritual phrasing of part of the information which ITS made publicly available about each user. This information (the INQUIR record) was a sort of form in which the user could fill out various fields. On display, two of these fields were always combined into a project description of the form "Hacking X for Y" (e.g. ""Hacking perceptrons for Minsky""). This form of description became traditional and has since been carried over to other systems with more general facilities for self-advertisement (such as Unix {plan files}). [{Jargon File}]

Biohacking - the activity of exploiting genetic material experimentally without regard to accepted ethical standards, or for criminal purposes. See /r/Biohackers

bondage-and-discipline language ::: A language (such as Pascal, Ada, APL, or Prolog) that, though ostensibly general-purpose, is designed so as to enforce an author's theory of right hacking or even vanilla general-purpose programming. Often abbreviated B&D; thus, one may speak of things having the B&D nature.See Pascal. Compare languages of choice.[Jargon File] (1996-01-05)

bondage-and-discipline language A language (such as {Pascal}, {Ada}, APL, or Prolog) that, though ostensibly general-purpose, is designed so as to enforce an author's theory of "right programming" even though said theory is demonstrably inadequate for systems hacking or even vanilla general-purpose programming. Often abbreviated "B&D"; thus, one may speak of things "having the B&D nature". See {Pascal}. Compare {languages of choice}. [{Jargon File}] (1996-01-05)

bushwhacking ::: n. --> Traveling, or working a way, through bushes; pulling by the bushes, as in hauling a boat along the bushy margin of a stream.
The crimes or warfare of bushwhackers.

Chaos Magic ::: Not a paradigm, but more of an approach to Western magic that emphasizes the flexibility of belief systems and the hacking of the fundamentals of consciousness in order to work will and affect reality. Four areas of practice notably characterizing some types of chaos magic are the application of sigils, the creation of unorthodox thoughtforms, the shifting of paradigms (sometimes even to the point of ludicrousness), and the usage of alternate methods of trance inductiuon and consciousness shifting (i.e. entheogenic journeying).

cubing "jargon" By analogy with "tubing", hacking on an IPSC ({Intel Personal SuperComputer}) hypercube. "Louella's gone cubing *again*!!" [{Jargon File}] (2003-10-09)

cubing ::: (jargon) By analogy with tubing, hacking on an IPSC (Intel Personal SuperComputer) hypercube. Louella's gone cubing *again*!

cyberpunk ::: /si:'ber-puhnk/ (Originally coined by SF writer Bruce Bethke and/or editor Gardner Dozois) A subgenre of SF launched in 1982 by William Gibson's but innovative Max Headroom TV series. See cyberspace, ice, jack in, go flatline.Since 1990 or so, popular culture has included a movement or fashion trend that calls itself cyberpunk, associated especially with the rave/techno subculture. hacking talent in those who have it. The general consensus is to tolerate them politely in hopes that they'll attract people who grow into being true hackers.[Jargon File]

cyberpunk /si:'ber-puhnk/ (Originally coined by SF writer Bruce Bethke and/or editor Gardner Dozois) A subgenre of SF launched in 1982 by William Gibson's epoch-making novel "Neuromancer" (though its roots go back through Vernor Vinge's "True Names" to John Brunner's 1975 novel "The Shockwave Rider"). Gibson's near-total ignorance of computers and the present-day hacker culture enabled him to speculate about the role of computers and hackers in the future in ways hackers have since found both irritatingly na"ive and tremendously stimulating. Gibson's work was widely imitated, in particular by the short-lived but innovative "Max Headroom" TV series. See {cyberspace}, {ice}, {jack in}, {go flatline}. Since 1990 or so, popular culture has included a movement or fashion trend that calls itself "cyberpunk", associated especially with the rave/techno subculture. Hackers have mixed feelings about this. On the one hand, self-described cyberpunks too often seem to be shallow trendoids in black leather who have substituted enthusiastic blathering about technology for actually learning and *doing* it. Attitude is no substitute for competence. On the other hand, at least cyberpunks are excited about the right things and properly respectful of hacking talent in those who have it. The general consensus is to tolerate them politely in hopes that they'll attract people who grow into being true hackers. [{Jargon File}]

death code A routine whose job is to set everything in the computer - {registers}, memory, flags - to zero, including that portion of memory where it is running; its last act is to stomp on its own "store zero" instruction. Death code isn't very useful, but writing it is an interesting hacking challenge on architectures where the instruction set makes it possible, such as the {PDP-8} or the {Data General} {Nova}. Perhaps the ultimate death code is on the {TI 990} series, where all {registers} are actually in {RAM}, and the instruction "store immediate 0" has the {opcode} 0. The {program counter} will immediately wrap around core as many times as it can until a user hits HALT. Any empty memory location is death code. Worse, the manufacturer recommended use of this instruction in startup code (which would be in {ROM} and therefore survive). [{Jargon File}]

finger ::: (tool) A Unix program that displays information about a particular user or all users logged on the system, or a remote system. Finger typically shows Hacking X for Y). Some versions take a -l (long) argument which yields more information.[Jargon File](2002-10-06)

finger "tool" A {Unix} program that displays information about a particular user or all users logged on the system, or a remote system. Finger typically shows full name, last login time, idle time, terminal line, and terminal location (where applicable). It may also display a {plan file} left by the user (see also {Hacking X for Y}). Some versions take a "-l" (long) argument which yields more information. [{Jargon File}] (2002-10-06)

firefighting ::: 1. What sysadmins have to do to correct sudden operational problems. An opposite of hacking. Been hacking your new newsreader? No, a power glitch hosed the network and I spent the whole afternoon fighting fires.2. The act of throwing lots of manpower and late nights at a project, especially to get it out before deadline. See also gang bang, Mongolian Hordes technique; however, the term firefighting connotes that the effort is going into chasing bugs rather than adding features. (1994-12-01)

firefighting 1. What sysadmins have to do to correct sudden operational problems. An opposite of hacking. "Been hacking your new newsreader?" "No, a power glitch hosed the network and I spent the whole afternoon fighting fires." 2. The act of throwing lots of manpower and late nights at a project, especially to get it out before deadline. See also {gang bang}, {Mongolian Hordes technique}; however, the term "firefighting" connotes that the effort is going into chasing bugs rather than adding features. (1994-12-01)

hackathon "jargon" A planned {hacking run} that is intended to last for about a week with lots of {hackers}. The term was used in 2005 by the {Apache} Foundation and the {OpenBSD} Project, among others. (2005-01-26)

hackathon ::: (jargon) A planned hacking run that is intended to last for about a week with lots of hackers. The term was used in 2005 by the Apache Foundation and the OpenBSD Project, among others.(2005-01-26)

hack attack "jargon" (Possibly by analogy with "Big Mac Attack" from advertisements for the McDonald's fast-food chain; the variant "big hack attack" is reported) Nearly synonymous with {hacking run}, though the latter more strongly implies an all-nighter. [{Jargon File}] (1996-08-26)

hack attack ::: (jargon) (Possibly by analogy with Big Mac Attack from advertisements for the McDonald's fast-food chain; the variant big hack attack is reported) Nearly synonymous with hacking run, though the latter more strongly implies an all-nighter.[Jargon File] (1996-08-26)

hacking ::: p. pr. & vb. n. --> of Hack

hacking run "jargon" (Analogy with "bombing run" or "speed run") A hack session extended long outside normal working times, especially one longer than 12 hours. May cause you to "change {phase} the hard way". [{Jargon File}] (1996-08-26)

hacking run ::: (jargon) (Analogy with bombing run or speed run) A hack session extended long outside normal working times, especially one longer than 12 hours. May cause you to change phase the hard way.[Jargon File] (1996-08-26)

hack "jargon" 1. Originally, a quick job that produces what is needed, but not well. 2. An incredibly good, and perhaps very time-consuming, piece of work that produces exactly what is needed. 3. To bear emotionally or physically. "I can't hack this heat!" 4. To work on something (typically a program). In an immediate sense: "What are you doing?" "I'm hacking TECO." In a general (time-extended) sense: "What do you do around here?" "I hack TECO." More generally, "I hack "foo"" is roughly equivalent to ""foo" is my major interest (or project)". "I hack solid-state physics." See {Hacking X for Y}. 5. To pull a prank on. See {hacker}. 6. To interact with a computer in a playful and exploratory rather than goal-directed way. "Whatcha up to?" "Oh, just hacking." 7. Short for {hacker}. 8. See {nethack}. 9. (MIT) To explore the basements, roof ledges, and steam tunnels of a large, institutional building, to the dismay of Physical Plant workers and (since this is usually performed at educational institutions) the Campus Police. This activity has been found to be eerily similar to playing adventure games such as {Dungeons and Dragons} and {Zork}. See also {vadding}. See also {neat hack}, {real hack}. [{Jargon File}] (1996-08-26)

hack ::: (jargon) 1. Originally, a quick job that produces what is needed, but not well.2. An incredibly good, and perhaps very time-consuming, piece of work that produces exactly what is needed.3. To bear emotionally or physically. I can't hack this heat!4. To work on something (typically a program). In an immediate sense: What are you doing? I'm hacking TECO. In a general (time-extended) sense: What do you equivalent to foo is my major interest (or project). I hack solid-state physics. See Hacking X for Y.5. To pull a prank on. See hacker.6. To interact with a computer in a playful and exploratory rather than goal-directed way. Whatcha up to? Oh, just hacking.7. Short for hacker.8. See nethack.9. (MIT) To explore the basements, roof ledges, and steam tunnels of a large, institutional building, to the dismay of Physical Plant workers and (since this activity has been found to be eerily similar to playing adventure games such as Dungeons and Dragons and Zork. See also vadding.See also neat hack, real hack.[Jargon File] (1996-08-26)

hack mode "jargon" Engaged in {hack}ing. A Zen-like state of total focus on The Problem that may be achieved when one is hacking (this is why every good hacker is part mystic). Ability to enter such concentration at will correlates strongly with wizardliness; it is one of the most important skills learned during {larval stage}. Sometimes amplified as "deep hack mode". Being yanked out of hack mode (see {priority interrupt}) may be experienced as a physical shock, and the sensation of being in hack mode is more than a little habituating. The intensity of this experience is probably by itself sufficient explanation for the existence of hackers, and explains why many resist being promoted out of positions where they can code. See also {cyberspace}. Some aspects of hackish etiquette will appear quite odd to an observer unaware of the high value placed on hack mode. For example, if someone appears at your door, it is perfectly okay to hold up a hand (without turning one's eyes away from the screen) to avoid being interrupted. One may read, type, and interact with the computer for quite some time before further acknowledging the other's presence (of course, he or she is reciprocally free to leave without a word). The understanding is that you might be in {hack mode} with a lot of delicate state in your head, and you dare not {swap} that context out until you have reached a good point to pause. See also {juggling eggs}. [{Jargon File}] (1996-07-31)

hack mode ::: (jargon) Engaged in hacking. A Zen-like state of total focus on The Problem that may be achieved when one is hacking (this is why every good hacker with wizardliness; it is one of the most important skills learned during larval stage. Sometimes amplified as deep hack mode.Being yanked out of hack mode (see priority interrupt) may be experienced as a physical shock, and the sensation of being in hack mode is more than a little explanation for the existence of hackers, and explains why many resist being promoted out of positions where they can code. See also cyberspace.Some aspects of hackish etiquette will appear quite odd to an observer unaware of the high value placed on hack mode. For example, if someone appears at your in your head, and you dare not swap that context out until you have reached a good point to pause. See also juggling eggs.[Jargon File] (1996-07-31)

hack ::: n. --> A frame or grating of various kinds; as, a frame for drying bricks, fish, or cheese; a rack for feeding cattle; a grating in a mill race, etc.
Unburned brick or tile, stacked up for drying.
A notch; a cut.
An implement for cutting a notch; a large pick used in breaking stone.
A hacking; a catch in speaking; a short, broken cough.

hand cruft "jargon" (After "hand craft") To write something {by hand} that would be better done automatically, e.g. writing {assembly language} instead of using a compiler (see {hand hacking}). [{Jargon File}] (2006-01-19)

hand cruft ::: (jargon) (After hand craft) To write something by hand that would be better done automatically, e.g. writing assembly language instead of using a compiler (see hand hacking).[Jargon File](2006-01-19)

hot spot ::: 1. (primarily used by C/Unix programmers, but spreading) It is received wisdom that in most programs, less than 10% of the code eats 90% of the execution time; code's central algorithm, as opposed to (say) initial set-up costs or large but infrequent I/O operations.See tune, bum, hand-hacking.2. The active location of a cursor on a bit-map display. Put the mouse's hot spot on the ON widget and click the left button.3. A screen region that is sensitive to mouse clicks, which trigger some action. Hypertext help screens are an example, in which a hot spot exists in the vicinity of any word for which additional material is available.4. In a massively parallel computer with shared memory, the one location that all 10,000 processors are trying to read or write at once (perhaps because they are all doing a busy-wait on the same lock).5. More generally, any place in a hardware design that turns into a performance bottleneck due to resource contention.[Jargon File] (1995-02-16)

hot spot 1. (primarily used by {C}/{Unix} programmers, but spreading) It is received wisdom that in most programs, less than 10% of the code eats 90% of the execution time; if one were to graph instruction visits versus code addresses, one would typically see a few huge spikes amidst a lot of low-level noise. Such spikes are called "hot spots" and are good candidates for heavy optimisation or {hand-hacking}. The term is especially used of tight loops and recursions in the code's central algorithm, as opposed to (say) initial set-up costs or large but infrequent I/O operations. See {tune}, {bum}, {hand-hacking}. 2. The active location of a cursor on a bit-map display. "Put the mouse's hot spot on the "ON" widget and click the left button." 3. A screen region that is sensitive to mouse clicks, which trigger some action. {Hypertext} help screens are an example, in which a hot spot exists in the vicinity of any word for which additional material is available. 4. In a {massively parallel} computer with {shared memory}, the one location that all 10,000 processors are trying to read or write at once (perhaps because they are all doing a {busy-wait} on the same lock). 5. More generally, any place in a hardware design that turns into a performance {bottleneck} due to resource contention. 6. {wireless hotspot}. [{Jargon File}] (1995-02-16)

ITS 1. Incompatible {time-sharing} System An influential but highly idiosyncratic {operating system} written for the {PDP-6} and {PDP-10} at {MIT} and long used at the {MIT AI Lab}. Much AI-hacker jargon derives from ITS folklore, and to have been "an ITS hacker" qualifies one instantly as an old-timer of the most venerable sort. ITS pioneered many important innovations, including transparent file sharing between machines and terminal-independent I/O. After about 1982, most actual work was shifted to newer machines, with the remaining ITS boxes run essentially as a hobby and service to the hacker community. The shutdown of the lab's last ITS machine in May 1990 marked the end of an era and sent old-time hackers into mourning nationwide (see {high moby}). The Royal Institute of Technology in Sweden is maintaining one "live" ITS site at its computer museum (right next to the only {TOPS-10} system still on the {Internet}), so ITS is still alleged to hold the record for OS in longest continuous use (however, {WAITS} is a credible rival for this palm). 2. A mythical image of {operating system} perfection worshiped by a bizarre, fervent retro-cult of old-time hackers and ex-users (see {troglodyte}). ITS worshipers manage somehow to continue believing that an OS maintained by {assembly language} hand-hacking that supported only monocase 6-character filenames in one directory per account remains superior to today's state of commercial art (their venom against {Unix} is particularly intense). See also {holy wars}, {Weenix}. [{Jargon File}] (1994-12-15)

languages of choice ::: C and Lisp. Nearly every hacker knows one of these, and most good ones are fluent in both. Smalltalk and Prolog are also popular in small but influential communities.There is also a rapidly dwindling category of older hackers with Fortran, or even assembler, as their language of choice. They often prefer to be known as hardware-specific uses in systems programs. Fortran occupies a shrinking niche in scientific programming.Most hackers tend to frown on languages like Pascal and Ada, which don't give them the near-total freedom considered necessary for hacking (see connected with COBOL or other traditional card walloper languages as a total and unmitigated loss.[Jargon File]

languages of choice {C} and {Lisp}. Nearly every hacker knows one of these, and most good ones are fluent in both. Smalltalk and Prolog are also popular in small but influential communities. There is also a rapidly dwindling category of older hackers with Fortran, or even assembler, as their language of choice. They often prefer to be known as {Real Programmers}, and other hackers consider them a bit odd (see "{The Story of Mel}"). Assembler is generally no longer considered interesting or appropriate for anything but {HLL} implementation, {glue}, and a few time-critical and hardware-specific uses in systems programs. Fortran occupies a shrinking niche in scientific programming. Most hackers tend to frown on languages like {Pascal} and {Ada}, which don't give them the near-total freedom considered necessary for hacking (see {bondage-and-discipline language}), and to regard everything even remotely connected with {COBOL} or other traditional {card walloper} languages as a total and unmitigated {loss}. [{Jargon File}]

larval stage Describes a period of monomaniacal concentration on coding apparently passed through by all fledgling hackers. Common symptoms include the perpetration of more than one 36-hour {hacking run} in a given week; neglect of all other activities including usual basics like food, sleep, and personal hygiene; and a chronic case of advanced bleary-eye. Can last from 6 months to 2 years, the apparent median being around 18 months. A few so afflicted never resume a more "normal" life, but the ordeal seems to be necessary to produce really wizardly (as opposed to merely competent) programmers. See also {wannabee}. A less protracted and intense version of larval stage (typically lasting about a month) may recur when one is learning a new {OS} or programming language. [{Jargon File}]

magic smoke ::: (electronics, humour) A substance trapped inside integrated circuit packages that enables them to function (also called blue smoke; this is is demonstrated by what happens when a chip burns up - the magic smoke gets let out, so it doesn't work any more.See Electing a Pope, smoke test.Usenetter Jay Maynard tells the following story:Once, while hacking on a dedicated Zilog Z80 system, I was testing code by blowing EPROMs and plugging them in the system, then seeing what happened. One still in service. Of course, this is because the magic smoke didn't get let out.Compare the original phrasing of Murphy's Law.[Jargon File] (1995-01-25)

magic smoke "electronics, humour" A substance trapped inside {integrated circuit} packages that enables them to function (also called "blue smoke"; this is similar to the archaic "phlogiston" hypothesis about combustion). Its existence is demonstrated by what happens when a chip burns up - the magic smoke gets let out, so it doesn't work any more. See {Electing a Pope}, {smoke test}. {Usenet}ter Jay Maynard tells the following story: "Once, while hacking on a dedicated {Zilog Z80} system, I was testing code by blowing {EPROMs} and plugging them in the system then seeing what happened. One time, I plugged one in backward. I only discovered that *after* I realised that {Intel} didn't put power-on lights under the quartz windows on the tops of their EPROMs - the die was glowing white-hot. Amazingly, the EPROM worked fine after I erased it, filled it full of zeros, then erased it again. For all I know, it's still in service. Of course, this is because the magic smoke didn't get let out." Compare the original phrasing of {Murphy's Law}. [{Jargon File}] (1995-01-25)

moria ::: (games) /mor'ee-*/ Like nethack and rogue, one of the large PD Dungeons and Dragons-like simulation games, available for a wide range of machines and days, elvish. The game is extremely addictive and a major consumer of time better used for hacking.[Jargon File]

moria "games" /mor'ee-*/ Like {nethack} and {rogue}, one of the large {PD} {Dungeons and Dragons}-like simulation games, available for a wide range of machines and operating systems. The name is from Tolkien's Mines of Moria; compare {elder days}, {elvish}. The game is extremely addictive and a major consumer of time better used for hacking. [{Jargon File}]

munchkin /muhnch'kin/ [Squeaky-voiced little people in L. Frank Baum's "The Wizard of Oz"] A teenage-or-younger micro enthusiast hacking BASIC or something else equally constricted. A term of mild derision - munchkins are annoying but some grow up to be hackers after passing through a {larval stage}. The term {urchin} is also used. See also {wannabee}, {bitty box}. [{Jargon File}]

munchkin ::: /muhnch'kin/ [Squeaky-voiced little people in L. Frank Baum's The Wizard of Oz] A teenage-or-younger micro enthusiast hacking BASIC or something else grow up to be hackers after passing through a larval stage. The term urchin is also used. See also wannabee, bitty box.[Jargon File]

neep-neep ::: /neep neep/ [onomatopoeic, from New York SF fandom] One who is fascinated by computers. Less specific than hacker, as it need not imply more skill than is in wide use). Fandom has a related proverb to the effect that Hacking is a conversational black hole!.[Jargon File] (1994-11-29)

neep-neep /neep neep/ [onomatopoeic, from New York SF fandom] One who is fascinated by computers. Less specific than {hacker}, as it need not imply more skill than is required to {boot} {games} on a {personal computer}. The derived noun "neeping" applies specifically to the long conversations about computers that tend to develop in the corners at most SF-convention parties (the term "neepery" is also in wide use). Fandom has a related proverb to the effect that "Hacking is a conversational black hole!". [{Jargon File}] (1994-11-29)

PEEK The command in most {microcomputer} {BASICs} for reading memory contents (a byte) at an absolute address. POKE is the corresponding command to write a value to an absolute address. This is often extended to mean the corresponding constructs in any {High Level Language}. Much hacking on small {microcomputers} without {MMUs} consists of "peek"ing around memory, more or less at random, to find the location where the system keeps interesting stuff. Long (and variably accurate) lists of such addresses for various computers circulate (see {interrupt list}). The results of "poke"s at these addresses may be highly useful, mildly amusing, useless but neat, or total {lossage} (see {killer poke}). Since a {real operating system} provides useful, higher-level services for the tasks commonly performed with peeks and pokes on micros, and real languages tend not to encourage low-level memory groveling, a question like "How do I do a peek in C?" is diagnostic of the {newbie}. Of course, {operating system} {kernels} often have to do exactly this; a real {C} hacker would unhesitatingly, if unportably, assign an absolute address to a pointer variable and indirect through it. [{Jargon File}] (1995-01-31)

PEEK ::: The command in most microcomputer BASICs for reading memory contents (a byte) at an absolute address. POKE is the corresponding command to write a value to an absolute address.This is often extended to mean the corresponding constructs in any High Level Language.Much hacking on small microcomputers without MMUs consists of peeking around memory, more or less at random, to find the location where the system keeps these addresses may be highly useful, mildly amusing, useless but neat, or total lossage (see killer poke).Since a real operating system provides useful, higher-level services for the tasks commonly performed with peeks and pokes on micros, and real languages tend have to do exactly this; a real C hacker would unhesitatingly, if unportably, assign an absolute address to a pointer variable and indirect through it.[Jargon File] (1995-01-31)

percussive maintenance "jargon" The fine art of whacking a device to get it working, possibly using a {fine adjuster}. (1999-01-15)

percussive maintenance ::: (jargon) The fine art of whacking a device to get it working, possibly using a fine adjuster. (1999-01-15)

phreaking "jargon" /freek'ing/ "phone phreak" 1. The art and science of {cracking} the telephone network so as, for example, to make free long-distance calls. 2. By extension, security-{cracking} in any other context (especially, but not exclusively, on communications networks). At one time phreaking was a semi-respectable activity among hackers; there was a gentleman's agreement that phreaking as an intellectual game and a form of exploration was OK, but serious theft of services was taboo. There was significant crossover between the hacker community and the hard-core phone phreaks who ran semi-underground networks of their own through such media as the legendary "TAP Newsletter". This ethos began to break down in the mid-1980s as wider dissemination of the techniques put them in the hands of less responsible phreaks. Around the same time, changes in the phone network made old-style technical ingenuity less effective as a way of hacking it, so phreaking came to depend more on overtly criminal acts such as stealing phone-card numbers. The crimes and punishments of gangs like the "414 group" turned that game very ugly. A few old-time hackers still phreak casually just to keep their hand in, but most these days have hardly even heard of "blue boxes" or any of the other paraphernalia of the great phreaks of yore. [{Jargon File}] (1994-11-09)

phreaking ::: (jargon) /freek'ing/ phone phreak 1. The art and science of cracking the telephone network so as, for example, to make free long-distance calls.2. By extension, security-cracking in any other context (especially, but not exclusively, on communications networks).At one time phreaking was a semi-respectable activity among hackers; there was a gentleman's agreement that phreaking as an intellectual game and a form of phreaks who ran semi-underground networks of their own through such media as the legendary TAP Newsletter.This ethos began to break down in the mid-1980s as wider dissemination of the techniques put them in the hands of less responsible phreaks. Around the same effective as a way of hacking it, so phreaking came to depend more on overtly criminal acts such as stealing phone-card numbers.The crimes and punishments of gangs like the 414 group turned that game very ugly. A few old-time hackers still phreak casually just to keep their hand in, but most these days have hardly even heard of blue boxes or any of the other paraphernalia of the great phreaks of yore.[Jargon File] (1994-11-09)

plan file ::: (operating system) On Unix systems that support finger, the .plan file in a user's home directory is displayed when the user is fingered. This feature humorous and self-expressive purposes (like a sig block). See also Hacking X for Y.A later innovation in plan files was the introduction of scrolling plan files which are one-dimensional animations made using only the printable ASCII sequences, since the finger command will (for security reasons; see letterbomb) not pass the escape character.Scrolling .plan files have become art forms in miniature, and some sites have started competitions to find who can create the longest running, funniest, and most original animations. A compiler (ASP) is available on Usenet for producing them. Typical animation components include: Centipede: mmmmmeLorry/Truck: oo-oP a much richer forum for the publication of personal minutiae and digital creativity.See also twirling baton.[Jargon File] (1998-01-16)

plan file "operating system" On {Unix} systems that support {finger}, the ".plan" file in a user's {home directory} is displayed when the user is fingered. This feature was originally intended to be used to keep potential fingerers apprised of one's location and near-future plans, but has been turned almost universally to humorous and self-expressive purposes (like a {sig block}). See also {Hacking X for Y}. A later innovation in plan files was the introduction of "scrolling plan files" which are one-dimensional animations made using only the printable {ASCII} character set, {carriage return} and {line feed}, avoiding terminal specific {escape sequences}, since the {finger} command will (for security reasons; see {letterbomb}) not pass the {escape} character. Scrolling .plan files have become art forms in miniature, and some sites have started competitions to find who can create the longest running, funniest, and most original animations. A compiler (ASP) is available on {Usenet} for producing them. Typical animation components include: Centipede: mmmmme Lorry/Truck: oo-oP Andalusian Video Snail: _@/ In the mid-1990s {WWW} {home pages} largely supplanted .plan files, providing a much richer forum for the publication of personal minutiae and digital creativity. See also {twirling baton}. [{Jargon File}] (1998-01-16)

prime time ::: (From TV programming) Normal high-usage hours on a time-sharing system; the day shift. Avoidance of prime time was traditionally given as a major reason for along with time-sharing itself, almost obsolete. The hackish tendency to late-night hacking runs has changed not a bit.[Jargon File] (1995-01-18)

prime time (From TV programming) Normal high-usage hours on a {time-sharing} system; the day shift. Avoidance of prime time was traditionally given as a major reason for {night mode} hacking. The rise of the personal workstation has rendered this term, along with {time-sharing} itself, almost obsolete. The hackish tendency to late-night {hacking runs} has changed not a bit. [{Jargon File}] (1995-01-18)

programming fluid "jargon" (Or "{wirewater}") Coffee, unleaded coffee (decaffeinated), Cola, or any caffeinacious stimulant. Many hackers consider these essential for those all-night {hacking runs}. (1996-05-01)

programming fluid ::: (jargon) (Or wirewater) Coffee, unleaded coffee (decaffeinated), Cola, or any caffeinacious stimulant. Many hackers consider these essential for those all-night hacking runs. (1996-05-01)

Rapid Application Development "programming" (RAD) A loose term for any {software life-cycle} designed to give faster development and better results and to take maximum advantage of recent advances in development software. RAD is associated with a wide range of approaches to software development: from hacking away in a {GUI builder} with little in the way of analysis and design to complete {methodologies} expanding on an {information engineering} framework. Some of the current RAD techniques are: {CASE} tools, {iterative life-cycles}, {prototyping}, {workshops}, {SWAT teams}, {timebox development}, and {Re-use} of applications, templates and code. {RAD at BSO/Den Haag (http://riv.nl/origin/company/denhaag/RAD.HTM)}. ["Rapid Application Development", James Martin]. (1995-09-23)

Rapid Application Development ::: (programming) (RAD) A loose term for any software life-cycle designed to give faster development and better results and to take maximum advantage of recent advances in development software.RAD is associated with a wide range of approaches to software development: from hacking away in a GUI builder with little in the way of analysis and design to complete methodologies expanding on an information engineering framework.Some of the current RAD techniques are: CASE tools, iterative life-cycles, prototyping, workshops, SWAT teams, timebox development, and Re-use of applications, templates and code. .[Rapid Application Development, James Martin]. (1995-09-23)

Real Programmers Don't Use Pascal ::: (humour) Back in the good old days - the Golden Era of computers, it was easy to separate the men from the boys (sometimes called Real Men and out that Real Men don't relate to anything, and aren't afraid of being impersonal.)But, as usual, times change. We are faced today with a world in which little old ladies can get computers in their microwave ovens, 12-year-old kids can blow danger of becoming extinct, of being replaced by high-school students with TRASH-80s.There is a clear need to point out the differences between the typical high-school junior Pac-Man player and a Real Programmer. If this difference is why it would be a mistake to replace the Real Programmers on their staff with 12-year-old Pac-Man players (at a considerable salary savings).LANGUAGESThe easiest way to tell a Real Programmer from the crowd is by the programming language he (or she) uses. Real Programmers use Fortran. Quiche Eaters use need all these abstract concepts to get their jobs done - they are perfectly happy with a keypunch, a Fortran IV compiler, and a beer.Real Programmers do List Processing in Fortran.Real Programmers do String Manipulation in Fortran.Real Programmers do Accounting (if they do it at all) in Fortran.Real Programmers do Artificial Intelligence programs in Fortran.If you can't do it in Fortran, do it in assembly language. If you can't do it in assembly language, it isn't worth doing.STRUCTURED PROGRAMMINGThe academics in computer science have gotten into the structured programming rut over the past several years. They claim that programs are more easily in the world won't help you solve a problem like that - it takes actual talent. Some quick observations on Real Programmers and Structured Programming:Real Programmers aren't afraid to use GOTOs.Real Programmers can write five-page-long DO loops without getting confused.Real Programmers like Arithmetic IF statements - they make the code more interesting.Real Programmers write self-modifying code, especially if they can save 20 nanoseconds in the middle of a tight loop.Real Programmers don't need comments - the code is obvious.Since Fortran doesn't have a structured IF, REPEAT ... UNTIL, or CASE statement, Real Programmers don't have to worry about not using them. Besides, they can be simulated when necessary using assigned GOTOs.Data Structures have also gotten a lot of press lately. Abstract Data Types, Structures, Pointers, Lists, and Strings have become popular in certain circles. Languages, as we all know, have implicit typing based on the first letter of the (six character) variable name.OPERATING SYSTEMSWhat kind of operating system is used by a Real Programmer? CP/M? God forbid - CP/M, after all, is basically a toy operating system. Even little old ladies and grade school students can understand and use CP/M.Unix is a lot more complicated of course - the typical Unix hacker never can remember what the PRINT command is called this week - but when it gets right systems: they send jokes around the world on UUCP-net and write adventure games and research papers.No, your Real Programmer uses OS 370. A good programmer can find and understand the description of the IJK305I error he just got in his JCL manual. A great outstanding programmer can find bugs buried in a 6 megabyte core dump without using a hex calculator. (I have actually seen this done.)OS is a truly remarkable operating system. It's possible to destroy days of work with a single misplaced space, so alertness in the programming staff is people claim there is a Time Sharing system that runs on OS 370, but after careful study I have come to the conclusion that they were mistaken.PROGRAMMING TOOLSWhat kind of tools does a Real Programmer use? In theory, a Real Programmer could run his programs by keying them into the front panel of the computer. Back the first operating system for the CDC7600 in on the front panel from memory when it was first powered on. Seymore, needless to say, is a Real Programmer.One of my favorite Real Programmers was a systems programmer for Texas Instruments. One day he got a long distance call from a user whose system had includes a keypunch and lineprinter in his toolkit, he can get along with just a front panel and a telephone in emergencies.In some companies, text editing no longer consists of ten engineers standing in line to use an 029 keypunch. In fact, the building I work in doesn't contain a system is called SmallTalk, and would certainly not talk to the computer with a mouse.Some of the concepts in these Xerox editors have been incorporated into editors running on more reasonably named operating systems - Emacs and VI being two. The the Real Programmer wants a you asked for it, you got it text editor - complicated, cryptic, powerful, unforgiving, dangerous. TECO, to be precise.It has been observed that a TECO command sequence more closely resembles transmission line noise than readable text [4]. One of the more entertaining will probably destroy your program, or even worse - introduce subtle and mysterious bugs in a once working subroutine.For this reason, Real Programmers are reluctant to actually edit a program that is close to working. They find it much easier to just patch the binary object Programmer to do the job - no Quiche Eating structured programmer would even know where to start. This is called job security.Some programming tools NOT used by Real Programmers:Fortran preprocessors like MORTRAN and RATFOR. The Cuisinarts of programming - great for making Quiche. See comments above on structured programming.Source language debuggers. Real Programmers can read core dumps.Compilers with array bounds checking. They stifle creativity, destroy most of the interesting uses for EQUIVALENCE, and make it impossible to modify the operating system code with negative subscripts. Worst of all, bounds checking is inefficient.Source code maintenance systems. A Real Programmer keeps his code locked up in a card file, because it implies that its owner cannot leave his important programs unguarded [5].THE REAL PROGRAMMER AT WORKWhere does the typical Real Programmer work? What kind of programs are worthy of the efforts of so talented an individual? You can be sure that no Real or sorting mailing lists for People magazine. A Real Programmer wants tasks of earth-shaking importance (literally!).Real Programmers work for Los Alamos National Laboratory, writing atomic bomb simulations to run on Cray I supercomputers.Real Programmers work for the National Security Agency, decoding Russian transmissions.It was largely due to the efforts of thousands of Real Programmers working for NASA that our boys got to the moon and back before the Russkies.Real Programmers are at work for Boeing designing the operating systems for cruise missiles.Some of the most awesome Real Programmers of all work at the Jet Propulsion Laboratory in California. Many of them know the entire operating system of the bytes of unused memory in a Voyager spacecraft that searched for, located, and photographed a new moon of Jupiter.The current plan for the Galileo spacecraft is to use a gravity assist trajectory past Mars on the way to Jupiter. This trajectory passes within 80 +/-3 kilometers of the surface of Mars. Nobody is going to trust a Pascal program (or a Pascal programmer) for navigation to these tolerances.As you can tell, many of the world's Real Programmers work for the U.S. Government - mainly the Defense Department. This is as it should be. Recently, programmers and Quiche Eaters alike.) Besides, the determined Real Programmer can write Fortran programs in any language.The Real Programmer might compromise his principles and work on something slightly more trivial than the destruction of life as we know it, providing Fortran, so there are a fair number of people doing graphics in order to avoid having to write COBOL programs.THE REAL PROGRAMMER AT PLAYGenerally, the Real Programmer plays the same way he works - with computers. He is constantly amazed that his employer actually pays him to do what he would be breath of fresh air and a beer or two. Some tips on recognizing Real Programmers away from the computer room:At a party, the Real Programmers are the ones in the corner talking about operating system security and how to get around it.At a football game, the Real Programmer is the one comparing the plays against his simulations printed on 11 by 14 fanfold paper.At the beach, the Real Programmer is the one drawing flowcharts in the sand.At a funeral, the Real Programmer is the one saying Poor George, he almost had the sort routine working before the coronary.In a grocery store, the Real Programmer is the one who insists on running the cans past the laser checkout scanner himself, because he never could trust keypunch operators to get it right the first time.THE REAL PROGRAMMER'S NATURAL HABITATWhat sort of environment does the Real Programmer function best in? This is an important question for the managers of Real Programmers. Considering the amount of money it costs to keep one on the staff, it's best to put him (or her) in an environment where he can get his work done.The typical Real Programmer lives in front of a computer terminal. Surrounding this terminal are:Listings of all programs the Real Programmer has ever worked on, piled in roughly chronological order on every flat surface in the office.Some half-dozen or so partly filled cups of cold coffee. Occasionally, there will be cigarette butts floating in the coffee. In some cases, the cups will contain Orange Crush.Unless he is very good, there will be copies of the OS JCL manual and the Principles of Operation open to some particularly interesting pages.Taped to the wall is a line-printer Snoopy calendar for the year 1969.Strewn about the floor are several wrappers for peanut butter filled cheese bars - the type that are made pre-stale at the bakery so they can't get any worse while waiting in the vending machine.Hiding in the top left-hand drawer of the desk is a stash of double-stuff Oreos for special occasions.Underneath the Oreos is a flowcharting template, left there by the previous occupant of the office. (Real Programmers write programs, not documentation. Leave that to the maintenance people.)The Real Programmer is capable of working 30, 40, even 50 hours at a stretch, under intense pressure. In fact, he prefers it that way. Bad response time project done on time, but creates a convenient excuse for not doing the documentation. In general:No Real Programmer works 9 to 5 (unless it's the ones at night).Real Programmers don't wear neckties.Real Programmers don't wear high-heeled shoes.Real Programmers arrive at work in time for lunch [9].A Real Programmer might or might not know his wife's name. He does, however, know the entire ASCII (or EBCDIC) code table.Real Programmers don't know how to cook. Grocery stores aren't open at three in the morning. Real Programmers survive on Twinkies and coffee.THE FUTUREWhat of the future? It is a matter of some concern to Real Programmers that the latest generation of computer programmers are not being brought up with the same ever learning Fortran! Are we destined to become an industry of Unix hackers and Pascal programmers?From my experience, I can only report that the future is bright for Real Programmers everywhere. Neither OS 370 nor Fortran show any signs of dying out, one of them has a way of converting itself back into a Fortran 66 compiler at the drop of an option card - to compile DO loops like God meant them to be.Even Unix might not be as bad on Real Programmers as it once was. The latest release of Unix has the potential of an operating system worthy of any Real in - like having the best parts of Fortran and assembly language in one place. (Not to mention some of the more creative uses for

Real Programmers Don't Use Pascal "humour" Back in the good old days - the "Golden Era" of computers, it was easy to separate the men from the boys (sometimes called "Real Men" and "Quiche Eaters" in the literature). During this period, the Real Men were the ones that understood computer programming, and the Quiche Eaters were the ones that didn't. A real computer programmer said things like "DO 10 I=1,10" and "ABEND" (they actually talked in capital letters, you understand), and the rest of the world said things like "computers are too complicated for me" and "I can't relate to computers - they're so impersonal". (A previous work [1] points out that Real Men don't "relate" to anything, and aren't afraid of being impersonal.) But, as usual, times change. We are faced today with a world in which little old ladies can get computers in their microwave ovens, 12-year-old kids can blow Real Men out of the water playing Asteroids and Pac-Man, and anyone can buy and even understand their very own Personal Computer. The Real Programmer is in danger of becoming extinct, of being replaced by high-school students with {TRASH-80s}. There is a clear need to point out the differences between the typical high-school junior Pac-Man player and a Real Programmer. If this difference is made clear, it will give these kids something to aspire to -- a role model, a Father Figure. It will also help explain to the employers of Real Programmers why it would be a mistake to replace the Real Programmers on their staff with 12-year-old Pac-Man players (at a considerable salary savings). LANGUAGES The easiest way to tell a Real Programmer from the crowd is by the programming language he (or she) uses. Real Programmers use {Fortran}. Quiche Eaters use {Pascal}. Nicklaus Wirth, the designer of Pascal, gave a talk once at which he was asked how to pronounce his name. He replied, "You can either call me by name, pronouncing it 'Veert', or call me by value, 'Worth'." One can tell immediately from this comment that Nicklaus Wirth is a Quiche Eater. The only parameter passing mechanism endorsed by Real Programmers is call-by-value-return, as implemented in the {IBM 370} {Fortran-G} and H compilers. Real programmers don't need all these abstract concepts to get their jobs done - they are perfectly happy with a {keypunch}, a {Fortran IV} {compiler}, and a beer. Real Programmers do List Processing in Fortran. Real Programmers do String Manipulation in Fortran. Real Programmers do Accounting (if they do it at all) in Fortran. Real Programmers do {Artificial Intelligence} programs in Fortran. If you can't do it in Fortran, do it in {assembly language}. If you can't do it in assembly language, it isn't worth doing. STRUCTURED PROGRAMMING The academics in computer science have gotten into the "structured programming" rut over the past several years. They claim that programs are more easily understood if the programmer uses some special language constructs and techniques. They don't all agree on exactly which constructs, of course, and the examples they use to show their particular point of view invariably fit on a single page of some obscure journal or another - clearly not enough of an example to convince anyone. When I got out of school, I thought I was the best programmer in the world. I could write an unbeatable tic-tac-toe program, use five different computer languages, and create 1000-line programs that WORKED. (Really!) Then I got out into the Real World. My first task in the Real World was to read and understand a 200,000-line Fortran program, then speed it up by a factor of two. Any Real Programmer will tell you that all the Structured Coding in the world won't help you solve a problem like that - it takes actual talent. Some quick observations on Real Programmers and Structured Programming: Real Programmers aren't afraid to use {GOTOs}. Real Programmers can write five-page-long DO loops without getting confused. Real Programmers like Arithmetic IF statements - they make the code more interesting. Real Programmers write self-modifying code, especially if they can save 20 {nanoseconds} in the middle of a tight loop. Real Programmers don't need comments - the code is obvious. Since Fortran doesn't have a structured IF, REPEAT ... UNTIL, or CASE statement, Real Programmers don't have to worry about not using them. Besides, they can be simulated when necessary using {assigned GOTOs}. Data Structures have also gotten a lot of press lately. Abstract Data Types, Structures, Pointers, Lists, and Strings have become popular in certain circles. Wirth (the above-mentioned Quiche Eater) actually wrote an entire book [2] contending that you could write a program based on data structures, instead of the other way around. As all Real Programmers know, the only useful data structure is the Array. Strings, lists, structures, sets - these are all special cases of arrays and can be treated that way just as easily without messing up your programing language with all sorts of complications. The worst thing about fancy data types is that you have to declare them, and Real Programming Languages, as we all know, have implicit typing based on the first letter of the (six character) variable name. OPERATING SYSTEMS What kind of operating system is used by a Real Programmer? CP/M? God forbid - CP/M, after all, is basically a toy operating system. Even little old ladies and grade school students can understand and use CP/M. Unix is a lot more complicated of course - the typical Unix hacker never can remember what the PRINT command is called this week - but when it gets right down to it, Unix is a glorified video game. People don't do Serious Work on Unix systems: they send jokes around the world on {UUCP}-net and write adventure games and research papers. No, your Real Programmer uses OS 370. A good programmer can find and understand the description of the IJK305I error he just got in his JCL manual. A great programmer can write JCL without referring to the manual at all. A truly outstanding programmer can find bugs buried in a 6 megabyte {core dump} without using a hex calculator. (I have actually seen this done.) OS is a truly remarkable operating system. It's possible to destroy days of work with a single misplaced space, so alertness in the programming staff is encouraged. The best way to approach the system is through a keypunch. Some people claim there is a Time Sharing system that runs on OS 370, but after careful study I have come to the conclusion that they were mistaken. PROGRAMMING TOOLS What kind of tools does a Real Programmer use? In theory, a Real Programmer could run his programs by keying them into the front panel of the computer. Back in the days when computers had front panels, this was actually done occasionally. Your typical Real Programmer knew the entire bootstrap loader by memory in hex, and toggled it in whenever it got destroyed by his program. (Back then, memory was memory - it didn't go away when the power went off. Today, memory either forgets things when you don't want it to, or remembers things long after they're better forgotten.) Legend has it that {Seymore Cray}, inventor of the Cray I supercomputer and most of Control Data's computers, actually toggled the first operating system for the CDC7600 in on the front panel from memory when it was first powered on. Seymore, needless to say, is a Real Programmer. One of my favorite Real Programmers was a systems programmer for Texas Instruments. One day he got a long distance call from a user whose system had crashed in the middle of saving some important work. Jim was able to repair the damage over the phone, getting the user to toggle in disk I/O instructions at the front panel, repairing system tables in hex, reading register contents back over the phone. The moral of this story: while a Real Programmer usually includes a keypunch and lineprinter in his toolkit, he can get along with just a front panel and a telephone in emergencies. In some companies, text editing no longer consists of ten engineers standing in line to use an 029 keypunch. In fact, the building I work in doesn't contain a single keypunch. The Real Programmer in this situation has to do his work with a "text editor" program. Most systems supply several text editors to select from, and the Real Programmer must be careful to pick one that reflects his personal style. Many people believe that the best text editors in the world were written at Xerox Palo Alto Research Center for use on their Alto and Dorado computers [3]. Unfortunately, no Real Programmer would ever use a computer whose operating system is called SmallTalk, and would certainly not talk to the computer with a mouse. Some of the concepts in these Xerox editors have been incorporated into editors running on more reasonably named operating systems - {Emacs} and {VI} being two. The problem with these editors is that Real Programmers consider "what you see is what you get" to be just as bad a concept in Text Editors as it is in women. No the Real Programmer wants a "you asked for it, you got it" text editor - complicated, cryptic, powerful, unforgiving, dangerous. TECO, to be precise. It has been observed that a TECO command sequence more closely resembles transmission line noise than readable text [4]. One of the more entertaining games to play with TECO is to type your name in as a command line and try to guess what it does. Just about any possible typing error while talking with TECO will probably destroy your program, or even worse - introduce subtle and mysterious bugs in a once working subroutine. For this reason, Real Programmers are reluctant to actually edit a program that is close to working. They find it much easier to just patch the binary {object code} directly, using a wonderful program called SUPERZAP (or its equivalent on non-IBM machines). This works so well that many working programs on IBM systems bear no relation to the original Fortran code. In many cases, the original source code is no longer available. When it comes time to fix a program like this, no manager would even think of sending anything less than a Real Programmer to do the job - no Quiche Eating structured programmer would even know where to start. This is called "job security". Some programming tools NOT used by Real Programmers: Fortran preprocessors like {MORTRAN} and {RATFOR}. The Cuisinarts of programming - great for making Quiche. See comments above on structured programming. Source language debuggers. Real Programmers can read core dumps. Compilers with array bounds checking. They stifle creativity, destroy most of the interesting uses for EQUIVALENCE, and make it impossible to modify the operating system code with negative subscripts. Worst of all, bounds checking is inefficient. Source code maintenance systems. A Real Programmer keeps his code locked up in a card file, because it implies that its owner cannot leave his important programs unguarded [5]. THE REAL PROGRAMMER AT WORK Where does the typical Real Programmer work? What kind of programs are worthy of the efforts of so talented an individual? You can be sure that no Real Programmer would be caught dead writing accounts-receivable programs in {COBOL}, or sorting {mailing lists} for People magazine. A Real Programmer wants tasks of earth-shaking importance (literally!). Real Programmers work for Los Alamos National Laboratory, writing atomic bomb simulations to run on Cray I supercomputers. Real Programmers work for the National Security Agency, decoding Russian transmissions. It was largely due to the efforts of thousands of Real Programmers working for NASA that our boys got to the moon and back before the Russkies. Real Programmers are at work for Boeing designing the operating systems for cruise missiles. Some of the most awesome Real Programmers of all work at the Jet Propulsion Laboratory in California. Many of them know the entire operating system of the Pioneer and Voyager spacecraft by heart. With a combination of large ground-based Fortran programs and small spacecraft-based assembly language programs, they are able to do incredible feats of navigation and improvisation - hitting ten-kilometer wide windows at Saturn after six years in space, repairing or bypassing damaged sensor platforms, radios, and batteries. Allegedly, one Real Programmer managed to tuck a pattern-matching program into a few hundred bytes of unused memory in a Voyager spacecraft that searched for, located, and photographed a new moon of Jupiter. The current plan for the Galileo spacecraft is to use a gravity assist trajectory past Mars on the way to Jupiter. This trajectory passes within 80 +/-3 kilometers of the surface of Mars. Nobody is going to trust a Pascal program (or a Pascal programmer) for navigation to these tolerances. As you can tell, many of the world's Real Programmers work for the U.S. Government - mainly the Defense Department. This is as it should be. Recently, however, a black cloud has formed on the Real Programmer horizon. It seems that some highly placed Quiche Eaters at the Defense Department decided that all Defense programs should be written in some grand unified language called "ADA" ((C), DoD). For a while, it seemed that ADA was destined to become a language that went against all the precepts of Real Programming - a language with structure, a language with data types, {strong typing}, and semicolons. In short, a language designed to cripple the creativity of the typical Real Programmer. Fortunately, the language adopted by DoD has enough interesting features to make it approachable -- it's incredibly complex, includes methods for messing with the operating system and rearranging memory, and Edsgar Dijkstra doesn't like it [6]. (Dijkstra, as I'm sure you know, was the author of "GoTos Considered Harmful" - a landmark work in programming methodology, applauded by Pascal programmers and Quiche Eaters alike.) Besides, the determined Real Programmer can write Fortran programs in any language. The Real Programmer might compromise his principles and work on something slightly more trivial than the destruction of life as we know it, providing there's enough money in it. There are several Real Programmers building video games at Atari, for example. (But not playing them - a Real Programmer knows how to beat the machine every time: no challenge in that.) Everyone working at LucasFilm is a Real Programmer. (It would be crazy to turn down the money of fifty million Star Trek fans.) The proportion of Real Programmers in Computer Graphics is somewhat lower than the norm, mostly because nobody has found a use for computer graphics yet. On the other hand, all computer graphics is done in Fortran, so there are a fair number of people doing graphics in order to avoid having to write COBOL programs. THE REAL PROGRAMMER AT PLAY Generally, the Real Programmer plays the same way he works - with computers. He is constantly amazed that his employer actually pays him to do what he would be doing for fun anyway (although he is careful not to express this opinion out loud). Occasionally, the Real Programmer does step out of the office for a breath of fresh air and a beer or two. Some tips on recognizing Real Programmers away from the computer room: At a party, the Real Programmers are the ones in the corner talking about operating system security and how to get around it. At a football game, the Real Programmer is the one comparing the plays against his simulations printed on 11 by 14 fanfold paper. At the beach, the Real Programmer is the one drawing flowcharts in the sand. At a funeral, the Real Programmer is the one saying "Poor George, he almost had the sort routine working before the coronary." In a grocery store, the Real Programmer is the one who insists on running the cans past the laser checkout scanner himself, because he never could trust keypunch operators to get it right the first time. THE REAL PROGRAMMER'S NATURAL HABITAT What sort of environment does the Real Programmer function best in? This is an important question for the managers of Real Programmers. Considering the amount of money it costs to keep one on the staff, it's best to put him (or her) in an environment where he can get his work done. The typical Real Programmer lives in front of a computer terminal. Surrounding this terminal are: Listings of all programs the Real Programmer has ever worked on, piled in roughly chronological order on every flat surface in the office. Some half-dozen or so partly filled cups of cold coffee. Occasionally, there will be cigarette butts floating in the coffee. In some cases, the cups will contain Orange Crush. Unless he is very good, there will be copies of the OS JCL manual and the Principles of Operation open to some particularly interesting pages. Taped to the wall is a line-printer Snoopy calendar for the year 1969. Strewn about the floor are several wrappers for peanut butter filled cheese bars - the type that are made pre-stale at the bakery so they can't get any worse while waiting in the vending machine. Hiding in the top left-hand drawer of the desk is a stash of double-stuff Oreos for special occasions. Underneath the Oreos is a flowcharting template, left there by the previous occupant of the office. (Real Programmers write programs, not documentation. Leave that to the maintenance people.) The Real Programmer is capable of working 30, 40, even 50 hours at a stretch, under intense pressure. In fact, he prefers it that way. Bad response time doesn't bother the Real Programmer - it gives him a chance to catch a little sleep between compiles. If there is not enough schedule pressure on the Real Programmer, he tends to make things more challenging by working on some small but interesting part of the problem for the first nine weeks, then finishing the rest in the last week, in two or three 50-hour marathons. This not only impresses the hell out of his manager, who was despairing of ever getting the project done on time, but creates a convenient excuse for not doing the documentation. In general: No Real Programmer works 9 to 5 (unless it's the ones at night). Real Programmers don't wear neckties. Real Programmers don't wear high-heeled shoes. Real Programmers arrive at work in time for lunch [9]. A Real Programmer might or might not know his wife's name. He does, however, know the entire {ASCII} (or EBCDIC) code table. Real Programmers don't know how to cook. Grocery stores aren't open at three in the morning. Real Programmers survive on Twinkies and coffee. THE FUTURE What of the future? It is a matter of some concern to Real Programmers that the latest generation of computer programmers are not being brought up with the same outlook on life as their elders. Many of them have never seen a computer with a front panel. Hardly anyone graduating from school these days can do hex arithmetic without a calculator. College graduates these days are soft - protected from the realities of programming by source level debuggers, text editors that count parentheses, and "user friendly" operating systems. Worst of all, some of these alleged "computer scientists" manage to get degrees without ever learning Fortran! Are we destined to become an industry of Unix hackers and Pascal programmers? From my experience, I can only report that the future is bright for Real Programmers everywhere. Neither OS 370 nor Fortran show any signs of dying out, despite all the efforts of Pascal programmers the world over. Even more subtle tricks, like adding structured coding constructs to Fortran have failed. Oh sure, some computer vendors have come out with Fortran 77 compilers, but every one of them has a way of converting itself back into a Fortran 66 compiler at the drop of an option card - to compile DO loops like God meant them to be. Even Unix might not be as bad on Real Programmers as it once was. The latest release of Unix has the potential of an operating system worthy of any Real Programmer - two different and subtly incompatible user interfaces, an arcane and complicated teletype driver, virtual memory. If you ignore the fact that it's "structured", even 'C' programming can be appreciated by the Real Programmer: after all, there's no type checking, variable names are seven (ten? eight?) characters long, and the added bonus of the Pointer data type is thrown in - like having the best parts of Fortran and assembly language in one place. (Not to mention some of the more creative uses for

slop "jargon" 1. A one-sided {fudge factor}, that is, an allowance for error but in only one of two directions. For example, if you need a piece of wire 10 feet long and have to guess when you cut it, you make very sure to cut it too long, by a large amount if necessary, rather than too short by even a little bit, because you can always cut off the slop but you can't paste it back on again. When discrete quantities are involved, slop is often introduced to avoid the possibility of being on the losing side of a {fencepost error}. 2. The percentage of "extra" code generated by a compiler over the size of equivalent {assembly code} produced by {hand-hacking}; i.e. the space (or maybe time) you lose because you didn't do it yourself. This number is often used as a measure of the quality of a compiler; slop below 5% is very good, and 10% is usually acceptable. Modern compilers, especially on {RISCs}, may actually have *negative* slop; that is, they may generate better code than humans. This is one of the reasons assembler programming is becoming less common. [{Jargon File}] (1995-05-28)

slop ::: (jargon) 1. A one-sided fudge factor, that is, an allowance for error but in only one of two directions. For example, if you need a piece of wire 10 feet When discrete quantities are involved, slop is often introduced to avoid the possibility of being on the losing side of a fencepost error.2. The percentage of extra code generated by a compiler over the size of equivalent assembly code produced by hand-hacking; i.e. the space (or maybe *negative* slop; that is, they may generate better code than humans. This is one of the reasons assembler programming is becoming less common.[Jargon File] (1995-05-28)

terminal brain death ::: The extreme form of terminal illness. What someone who has obviously been hacking continuously for far too long is said to be suffering from.[Jargon File]

terminal brain death The extreme form of {terminal illness}. What someone who has obviously been hacking continuously for far too long is said to be suffering from. [{Jargon File}]

The story of Mel, a Real Programmer "programming, person" A 1983 article by Ed Nather about {hacker} {Mel Kaye}. The full text follows. A recent article devoted to the macho side of programming made the bald and unvarnished statement, "Real Programmers write in FORTRAN". Maybe they do now, in this decadent era of Lite beer, hand calculators and "user-friendly" software but back in the Good Old Days, when the term "software" sounded funny and Real Computers were made out of {drums} and {vacuum tubes}, Real Programmers wrote in {machine code} - not {Fortran}, not {RATFOR}, not even {assembly language} - {Machine Code}, raw, unadorned, inscrutable {hexadecimal} numbers, directly. Lest a whole new generation of programmers grow up in ignorance of this glorious past, I feel duty-bound to describe, as best I can through the generation gap, how a Real Programmer wrote code. I'll call him Mel, because that was his name. I first met Mel when I went to work for {Royal McBee Computer Corporation}, a now-defunct subsidiary of the typewriter company. The firm manufactured the {LGP-30}, a small, cheap (by the standards of the day) {drum}-memory computer, and had just started to manufacture the RPC-4000, a much-improved, bigger, better, faster -- drum-memory computer. Cores cost too much, and weren't here to stay, anyway. (That's why you haven't heard of the company, or the computer.) I had been hired to write a {Fortran} compiler for this new marvel and Mel was my guide to its wonders. Mel didn't approve of compilers. "If a program can't rewrite its own code," he asked, "what good is it?" Mel had written, in {hexadecimal}, the most popular computer program the company owned. It ran on the {LGP-30} and played blackjack with potential customers at computer shows. Its effect was always dramatic. The LGP-30 booth was packed at every show, and the IBM salesmen stood around talking to each other. Whether or not this actually sold computers was a question we never discussed. Mel's job was to re-write the blackjack program for the {RPC-4000}. ({Port}? What does that mean?) The new computer had a one-plus-one addressing scheme, in which each machine instruction, in addition to the {operation code} and the address of the needed {operand}, had a second address that indicated where, on the revolving drum, the next instruction was located. In modern parlance, every single instruction was followed by a {GO TO}! Put *that* in {Pascal}'s pipe and smoke it. Mel loved the RPC-4000 because he could optimize his code: that is, locate instructions on the drum so that just as one finished its job, the next would be just arriving at the "read head" and available for immediate execution. There was a program to do that job, an "optimizing assembler", but Mel refused to use it. "You never know where its going to put things", he explained, "so you'd have to use separate constants". It was a long time before I understood that remark. Since Mel knew the numerical value of every operation code, and assigned his own drum addresses, every instruction he wrote could also be considered a numerical constant. He could pick up an earlier "add" instruction, say, and multiply by it, if it had the right numeric value. His code was not easy for someone else to modify. I compared Mel's hand-optimised programs with the same code massaged by the optimizing assembler program, and Mel's always ran faster. That was because the "{top-down}" method of program design hadn't been invented yet, and Mel wouldn't have used it anyway. He wrote the innermost parts of his program loops first, so they would get first choice of the optimum address locations on the drum. The optimizing assembler wasn't smart enough to do it that way. Mel never wrote time-delay loops, either, even when the balky {Flexowriter} required a delay between output characters to work right. He just located instructions on the drum so each successive one was just *past* the read head when it was needed; the drum had to execute another complete revolution to find the next instruction. He coined an unforgettable term for this procedure. Although "optimum" is an absolute term, like "unique", it became common verbal practice to make it relative: "not quite optimum" or "less optimum" or "not very optimum". Mel called the maximum time-delay locations the "most pessimum". After he finished the blackjack program and got it to run, ("Even the initialiser is optimised", he said proudly) he got a Change Request from the sales department. The program used an elegant (optimised) {random number generator} to shuffle the "cards" and deal from the "deck", and some of the salesmen felt it was too fair, since sometimes the customers lost. They wanted Mel to modify the program so, at the setting of a sense switch on the console, they could change the odds and let the customer win. Mel balked. He felt this was patently dishonest, which it was, and that it impinged on his personal integrity as a programmer, which it did, so he refused to do it. The Head Salesman talked to Mel, as did the Big Boss and, at the boss's urging, a few Fellow Programmers. Mel finally gave in and wrote the code, but he got the test backward, and, when the sense switch was turned on, the program would cheat, winning every time. Mel was delighted with this, claiming his subconscious was uncontrollably ethical, and adamantly refused to fix it. After Mel had left the company for greener pa$ture$, the Big Boss asked me to look at the code and see if I could find the test and reverse it. Somewhat reluctantly, I agreed to look. Tracking Mel's code was a real adventure. I have often felt that programming is an art form, whose real value can only be appreciated by another versed in the same arcane art; there are lovely gems and brilliant coups hidden from human view and admiration, sometimes forever, by the very nature of the process. You can learn a lot about an individual just by reading through his code, even in hexadecimal. Mel was, I think, an unsung genius. Perhaps my greatest shock came when I found an innocent loop that had no test in it. No test. *None*. Common sense said it had to be a closed loop, where the program would circle, forever, endlessly. Program control passed right through it, however, and safely out the other side. It took me two weeks to figure it out. The RPC-4000 computer had a really modern facility called an {index register}. It allowed the programmer to write a program loop that used an indexed instruction inside; each time through, the number in the index register was added to the address of that instruction, so it would refer to the next datum in a series. He had only to increment the index register each time through. Mel never used it. Instead, he would pull the instruction into a machine register, add one to its address, and store it back. He would then execute the modified instruction right from the register. The loop was written so this additional execution time was taken into account -- just as this instruction finished, the next one was right under the drum's read head, ready to go. But the loop had no test in it. The vital clue came when I noticed the index register bit, the bit that lay between the address and the operation code in the instruction word, was turned on-- yet Mel never used the index register, leaving it zero all the time. When the light went on it nearly blinded me. He had located the data he was working on near the top of memory -- the largest locations the instructions could address -- so, after the last datum was handled, incrementing the instruction address would make it overflow. The carry would add one to the operation code, changing it to the next one in the instruction set: a jump instruction. Sure enough, the next program instruction was in address location zero, and the program went happily on its way. I haven't kept in touch with Mel, so I don't know if he ever gave in to the flood of change that has washed over programming techniques since those long-gone days. I like to think he didn't. In any event, I was impressed enough that I quit looking for the offending test, telling the Big Boss I couldn't find it. He didn't seem surprised. When I left the company, the blackjack program would still cheat if you turned on the right sense switch, and I think that's how it should be. I didn't feel comfortable hacking up the code of a Real Programmer." [Posted to {Usenet} by its author, Ed Nather "utastro!nather", on 1983-05-21]. {Jargon File (http://www.catb.org/jargon/html/story-of-mel.html)}. [{On the trail of a Real Programmer (http://www.jamtronix.com/blog/2011/03/25/on-the-trail-of-a-real-programmer/)}, 2011-03-25 blog post by "jonno" at Jamtronix] [When did it happen? Did Mel use hexadecimal or octal?] (2003-09-12)

The story of Mel, a Real Programmer ::: (programming, person) An article devoted to the macho side of programming made the bald and unvarnished statement, Real Programmers write in Fortran. language - Machine Code. Raw, unadorned, inscrutable hexadecimal numbers, directly.Lest a whole new generation of programmers grow up in ignorance of this glorious past, I feel duty-bound to describe, as best I can through the generation gap, how a Real Programmer wrote code. I'll call him Mel, because that was his name.I first met Mel when I went to work for Royal McBee Computer Corporation, a now-defunct subsidiary of the typewriter company. The firm manufactured the faster -- drum-memory computer. Cores cost too much, and weren't here to stay, anyway. (That's why you haven't heard of the company, or the computer.)I had been hired to write a Fortran compiler for this new marvel and Mel was my guide to its wonders. Mel didn't approve of compilers.If a program can't rewrite its own code, he asked, what good is it?Mel had written, in hexadecimal, the most popular computer program the company owned. It ran on the LGP-30 and played blackjack with potential customers at every show, and the IBM salesmen stood around talking to each other. Whether or not this actually sold computers was a question we never discussed.Mel's job was to re-write the blackjack program for the RPC-4000. (Port? What does that mean?) The new computer had a one-plus-one addressing scheme, in which drum, the next instruction was located. In modern parlance, every single instruction was followed by a GO TO! Put *that* in Pascal's pipe and smoke it.Mel loved the RPC-4000 because he could optimize his code: that is, locate instructions on the drum so that just as one finished its job, the next would be was a program to do that job, an optimizing assembler, but Mel refused to use it.You never know where its going to put things, he explained, so you'd have to use separate constants.It was a long time before I understood that remark. Since Mel knew the numerical value of every operation code, and assigned his own drum addresses, every pick up an earlier add instruction, say, and multiply by it, if it had the right numeric value. His code was not easy for someone else to modify.I compared Mel's hand-optimised programs with the same code massaged by the optimizing assembler program, and Mel's always ran faster. That was because the they would get first choice of the optimum address locations on the drum. The optimizing assembler wasn't smart enough to do it that way.Mel never wrote time-delay loops, either, even when the balky Flexowriter required a delay between output characters to work right. He just located practice to make it relative: not quite optimum or less optimum or not very optimum. Mel called the maximum time-delay locations the most pessimum.After he finished the blackjack program and got it to run, (Even the initialiser is optimised, he said proudly) he got a Change Request from the Mel to modify the program so, at the setting of a sense switch on the console, they could change the odds and let the customer win.Mel balked. He felt this was patently dishonest, which it was, and that it impinged on his personal integrity as a programmer, which it did, so he refused program would cheat, winning every time. Mel was delighted with this, claiming his subconscious was uncontrollably ethical, and adamantly refused to fix it.After Mel had left the company for greener pa$ture$, the Big Boss asked me to look at the code and see if I could find the test and reverse it. Somewhat reluctantly, I agreed to look. Tracking Mel's code was a real adventure.I have often felt that programming is an art form, whose real value can only be appreciated by another versed in the same arcane art; there are lovely gems and reading through his code, even in hexadecimal. Mel was, I think, an unsung genius.Perhaps my greatest shock came when I found an innocent loop that had no test in it. No test. *None*. Common sense said it had to be a closed loop, where the it, however, and safely out the other side. It took me two weeks to figure it out.The RPC-4000 computer had a really modern facility called an index register. It allowed the programmer to write a program loop that used an indexed instruction address of that instruction, so it would refer to the next datum in a series. He had only to increment the index register each time through. Mel never used it.Instead, he would pull the instruction into a machine register, add one to its address, and store it back. He would then execute the modified instruction right taken into account -- just as this instruction finished, the next one was right under the drum's read head, ready to go. But the loop had no test in it.The vital clue came when I noticed the index register bit, the bit that lay between the address and the operation code in the instruction word, was turned on-- yet Mel never used the index register, leaving it zero all the time. When the light went on it nearly blinded me.He had located the data he was working on near the top of memory -- the largest locations the instructions could address -- so, after the last datum was instruction set: a jump instruction. Sure enough, the next program instruction was in address location zero, and the program went happily on its way.I haven't kept in touch with Mel, so I don't know if he ever gave in to the flood of change that has washed over programming techniques since those that I quit looking for the offending test, telling the Big Boss I couldn't find it. He didn't seem surprised.When I left the company, the blackjack program would still cheat if you turned on the right sense switch, and I think that's how it should be. I didn't feel comfortable hacking up the code of a Real Programmer.[Posted to USENET by its author, Ed Nather utastro!nather>, on 1983-05-21]. .[When did it happen? Did Mel use hexadecimal or octal?](2003-09-12)

toy A computer system; always used with qualifiers. 1. "nice toy": One that supports the speaker's hacking style adequately. 2. "just a toy": A machine that yields insufficient {computrons} for the speaker's preferred uses. This is not condemnatory, as is {bitty box}; toys can at least be fun. It is also strongly conditioned by one's expectations; Cray XMP users sometimes consider the Cray-1 a "toy", and certainly all RISC boxes and mainframes are toys by their standards. See also {Get a real computer!}. [{Jargon File}]

toy ::: A computer system; always used with qualifiers.1. nice toy: One that supports the speaker's hacking style adequately.2. just a toy: A machine that yields insufficient computrons for the speaker's preferred uses. This is not condemnatory, as is bitty box; toys can at least be sometimes consider the Cray-1 a toy, and certainly all RISC boxes and mainframes are toys by their standards. See also Get a real computer!.[Jargon File]

tube time ::: Time spent at a terminal or console. More inclusive than hacking time; commonly used in discussions of what parts of one's environment one uses most heavily. I find I'm spending too much of my tube time reading mail since I started this revision.[Jargon File]

tube time Time spent at a terminal or console. More inclusive than hacking time; commonly used in discussions of what parts of one's environment one uses most heavily. "I find I'm spending too much of my tube time reading mail since I started this revision." [{Jargon File}]

tune ::: (jargon) (From musical, possibly via automotive, usage) To optimise a program or system for a particular environment, especially by adjusting lines in C. One may tune for time (fastest execution), tune for space (least memory use), or tune for configuration (most efficient use of hardware).See bum, hot spot, hand-hacking.[Jargon File] (1999-06-05)

tune "jargon" (From musical, possibly via automotive, usage) To {optimise} a program or system for a particular environment, especially by adjusting numerical parameters designed as {hooks} for tuning, e.g. by changing "

vadding "games" /vad'ing/ (From VAD, a permutation of ADV, i.e. {ADVENT}, used to avoid a particular {admin}'s continual search-and-destroy sweeps for the game) A leisure-time activity of certain hackers involving the covert exploration of the "secret" parts of large buildings - basements, roofs, freight elevators, maintenance crawlways, steam tunnels, and the like. A few go so far as to learn locksmithing in order to synthesise vadding keys. The verb is "to vad" (compare {phreaking}; see also {hack}, sense 9). This term dates from the late 1970s, before which such activity was simply called "hacking"; the older usage is still prevalent at {MIT}. Vadding (pronounced /vay'ding/) was also popular {CMU}, at least as early as 1986. People who did it every night were called the "vaders," possibly after "elevator," which was one of the things they played with, or "invader," or "Darth Vader". This game was usually played along with no-holds-barred hide-and-seek. CMU grad students were the known to pry open the inner doors of elevators between floors to see the graffiti on the inside of the outer doors. The most extreme and dangerous form of vadding is "elevator rodeo", also known as "elevator surfing", a sport played by wrasslin' down a thousand-pound elevator car with a 3-foot piece of string, and then exploiting this mastery in various stimulating ways (such as elevator hopping, shaft exploration, rat-racing, and the ever-popular drop experiments). Kids, don't try this at home! See also {hobbit}. [{Jargon File}] (1996-01-07)

vadding ::: (games) /vad'ing/ (From VAD, a permutation of ADV, i.e. ADVENT, used to avoid a particular admin's continual search-and-destroy sweeps for the game) A which such activity was simply called hacking; the older usage is still prevalent at MIT.Vadding (pronounced /vay'ding/) was also popular CMU, at least as early as 1986. People who did it every night were called the vaders, possibly after hide-and-seek. CMU grad students were the known to pry open the inner doors of elevators between floors to see the graffiti on the inside of the outer doors.The most extreme and dangerous form of vadding is elevator rodeo, also known as elevator surfing, a sport played by wrasslin' down a thousand-pound rat-racing, and the ever-popular drop experiments). Kids, don't try this at home!See also hobbit.[Jargon File] (1996-01-07)

wank /wangk/ [Columbia University: probably by mutation from Commonwealth slang "wank", to masturbate] Used much as {hack} is elsewhere, as a noun denoting a clever technique or person or the result of such cleverness. May describe (negatively) the act of hacking for hacking's sake ("Quit wanking, let's go get supper!") or (more positively) a {wizard}. "wanky" describes something particularly clever (a person, program, or algorithm). Conversations can also get wanky when there are too many wanks involved. This excess wankiness is signalled by an overload of the "wankometer" (compare {bogometer}). When the wankometer overloads, the conversation's subject must be changed, or all non-wanks will leave. Compare "neep-neeping" (under {neep-neep}). Usage: US only. In Britain and the Commonwealth this word is *extremely* rude and is best avoided unless one intends to give offense.

whacker [University of Maryland: from {hacker}] 1. A person, similar to a {hacker}, who enjoys exploring the details of programmable systems and how to stretch their capabilities. Whereas a hacker tends to produce great hacks, a whacker only ends up whacking the system or program in question. Whackers are often quite egotistical and eager to claim {wizard} status, regardless of the views of their peers. 2. A person who is good at programming quickly, though rather poorly and ineptly.

whacking ::: p. pr. & vb. n. --> of Whack ::: a. --> Very large; whapping.

wizard 1. A person who knows how a complex piece of software or hardware works (that is, who {groks} it); especially someone who can find and fix bugs quickly in an emergency. Someone is a {hacker} if he or she has general hacking ability, but is a wizard with respect to something only if he or she has specific detailed knowledge of that thing. A good hacker could become a wizard for something given the time to study it. 2. A person who is permitted to do things forbidden to ordinary people; one who has {wheel} privileges on a system. 3. A Unix expert, especially a Unix systems programmer. This usage is well enough established that "Unix Wizard" is a recognised job title at some corporations and to most headhunters. See {guru}, {lord high fixer}. See also {deep magic}, {heavy wizardry}, {incantation}, {magic}, {mutter}, {rain dance}, {voodoo programming}, {wave a dead chicken}. 4. An interactive help utility that guides the user through a potentially complex task, such as configuring a {PPP} driver to work with a new {modem}. Wizards are often implemented as a sequence of {dialog boxes} which the user can move forward and backward through, filling in the details required. The implication is that the expertise of a human wizard in one of the above senses is encapsulated in the software wizard, allowing the average user to perform expertly. [{Jargon File}] (1998-09-07)

You know you've been hacking too long when... ::: The set-up line for a genre of one-liners told by hackers about themselves. These include the following:* Not only do you check your e-mail more often than your paper mail, but you remember your network address faster than your postal one.* Your SO kisses you on the neck and the first thing you think is Uh, oh, priority interrupt.* You go to balance your chequebook and discover that you're doing it in octal.* Your computers have a higher street value than your car.* In your universe, round numbers are powers of 2, not 10.* You have woken up recalling a dream in some programming language.* You realise you have never seen half of your best friends.[An early version of this entry said All but one of these have been reliably reported as hacker traits (some of them quite often). Even hackers may have reports of its actually happening, most famously to Grace Hopper while she was working with BINAC in 1949. - ESR] (1995-04-07)

KEYS (10k)

   1 Wikipedia
   1 Kevin Mitnick
   1 Henry David Thoreau

NEW FULL DB (2.4M)

   39 Ian Hacking
   13 Kevin Mitnick
   10 Ryan Holiday
   9 Stephen R Covey
   7 Reince Priebus
   6 Donald Trump
   6 Barack Obama
   5 Rick Riordan
   5 Michael Demon Calce
   5 Anonymous
   5 Amy Poehler
   4 Wendelin Van Draanen
   4 Henry David Thoreau
   3 Tim Cook
   3 Rush Limbaugh
   3 Roger Stone
   3 Richard Stallman
   3 Neal Stephenson
   3 Fred Kaplan
   3 Edward Snowden

1:My primary goal of hacking was the intellectual curiosity, the seduction of adventure.    ~ Kevin Mitnick,

2:There are a thousand hacking at the branches of evil to one who is striking at the root. ~ Henry David Thoreau,

3:Kusanagi is a leading expert in fourth-generation warfare and cyberbrain combative warfare. As the most heavily mechanized member of Section 9, she is regarded amongst her peers as the best hand-to-hand melee fighter and the most skilled "hacker and net diver." Chief Aramaki described her abilities as "...rarer than 'ESP'; the kind of person that government agencies hire to assassinate without leaving a trace." Classified as "Wizard Class" grey hat, her computer security hacking skills allow her brain-computer interface consciousness to control two-external humanoid "drone"-robots remotely with the ability to move her "ghost" from host to host. Kusanagi repeatedly demonstrates uncanny ability to hack people's wetware protected with military-grade malware protection and counter-measures, allowing her to "see through their eyes," disable their vocal systems, or even take control of their bodies altogether. As a cyborg, Kusanagi is able to perform numerous superhuman feats, such as demonstrating superhuman strength, leaping between skyscrapers, advanced acrobatics, or shooting down a bullet after it was fired at mid-range. ~ Wikipedia, Motoko Kusangi,

*** WISDOM TROVE ***

1:You can do reverse engineering, but you can’t do reverse hacking. ~ francis-crick, @wisdomtrove

2:The truth is revealed by removing things that stand in its light, an art not unlike sculpture, in which the artist creates, not by building, but by hacking away. ~ alan-watts, @wisdomtrove

*** NEWFULLDB 2.4M ***

1:Handed Down In High-Profile Phone Hacking Case ~ Anonymous,

2:Acceptance means commitment, among other things. ~ Ian Hacking,

3:Growth HAcking is more of a mindset that a tool kit ~ Ryan Holiday,

4:German reminded her of an old man hacking up phlegm. ~ Sara Shepard,

5:Death is hacking away at my address book and party lists. ~ Mason Cooley,

6:Each of us becomes a new person as we redescribe the past. ~ Ian Hacking,

7:Growth hacking really is a mindset rather than a tool kit. ~ Ryan Holiday,

8:The Atlantic con el título: «Hacking the President’s DNA». Si ~ Timothy Ferriss,

9:People are running huge enterprises off of hacking and stealing data. ~ Tim Cook,

10:As we have seen, bacteria have ways of hacking into the nervous system. ~ Ed Yong,

11:You can do reverse engineering, but you can’t do reverse hacking. ~ Francis Crick,

12:As a young boy, I was taught in high school that hacking was cool. ~ Kevin Mitnick,

13:You have no idea whether the hacking even influenced the election. ~ Reince Priebus,

14:If somebody's hacking you, you don't want them to know that you know. ~ Nancy Pelosi,

15:Probability fractions arise from our knowledge and from our ignorance. ~ Ian Hacking,

16:The final arbitrator in philosophy is not how we think but what we do. ~ Ian Hacking,

17:The Russians stole from the Democratic National Committee with hacking. ~ E J Dionne,

18:It's less about technology for me, and more about religion. [on hacking] ~ Adri n Lamo,

19:It’s not about hacking computers anymore; it’s about hacking human souls. ~ John Green,

20:In each case you settle on an act. Doing nothing at all counts as an act. ~ Ian Hacking,

21:Opinion is the companion of probability within the medieval epistemology. ~ Ian Hacking,

22:The best reaction to a paradox is to invent a genuinely new and deep idea. ~ Ian Hacking,

23:hacking the website of an academic journal to change the referees’ reports. ~ Jean Tirole,

24:Hillary Clinton has taught us really how vulnerable we are in cyber hacking. ~ Donald Trump,

25:Statistics began as the systematic study of quantitative facts about the state. ~ Ian Hacking,

26:In their view, hacking would be better served by using the best system possible. ~ Steven Levy,

27:Playfully doing something difficult, whether useful or not, that is hacking. ~ Richard Stallman,

28:Air warfare is a shot through the brain, not a hacking to pieces of the enemy's body. ~ J F C Fuller,

29:What's hard, in hacking as in fiction, is not writing, it's deciding what to write. ~ Neal Stephenson,

30:For every thousand hacking at the leaves of evil, there is one striking at the root. ~ Stephen R Covey,

31:My primary goal of hacking was the intellectual curiosity, the seduction of adventure. ~ Kevin Mitnick,

32:[ Cyber hacking] that's probably the only thing that we've learned from Hillary Clinton. ~ Donald Trump,

33:Despair leads to boredom, electronic games, computer hacking, poetry and other bad habits. ~ Edward Abbey,

34:My primary goal of hacking was the intellectual curiosity, the seduction of adventure.    ~ Kevin Mitnick,

35:for every thousand hacking at the leaves of evil , there is one hacking at the root .... ~ Stephen R Covey,

36:For every thousand hacking at the leaves of evil, there is one striking at the root.” We ~ Stephen R Covey,

37:A lot of hacking is playing with other people, you know, getting them to do strange things. ~ Steve Wozniak,

38:Underground: Tales of Hacking, Madness and Obsession from the Electronic Frontier—a ~ Daniel Domscheit Berg,

39:When I was hacking, it was more pushing the status quo and seeing how far you can go. ~ Michael Demon Calce,

40:Back in my era, hacking was all about messing with other hackers. It was a hacker war. ~ Michael Demon Calce,

41:Plutonium has a quite extraordinary relationship with people. They made it, and it kills them. ~ Ian Hacking,

42:There are thousand hacking at the branches of evil to one who is striking at the root. ~ Henry David Thoreau,

43:Whereas marketing was once brand-based, with growth hacking it becomes metric and ROI driven. ~ Ryan Holiday,

44:I could have evaded the FBI a lot longer if I had been able to control my passion for hacking. ~ Kevin Mitnick,

45:There are a thousand hacking at the branches of evil to one who is striking at the root. ~ Henry David Thoreau,

46:For every thousand hacking at the leaves of evil, there is one striking at the root - Thoreau ~ Stephen R Covey,

47:for every thousand people hacking at the leaves of evil, there is one striking at the roots. ~ Stephen M R Covey,

48:By legend and perhaps by nature philosophers are more accustomed to the armchair than the workbench. ~ Ian Hacking,

49:Molecular biology has routinely taken problematic things under its wing without altering core ideas. ~ Ian Hacking,

50:director of growth at StumbleUpon, put it best: growth hacking is more of a mindset than a tool kit. ~ Ryan Holiday,

51:people hack into the library to rehearse hacking into bigger, more secure, and more valuable targets. ~ Susan Orlean,

52:The Democratic Party would like to see an open independent bipartisan investigation [about hacking]. ~ Donna Brazile,

53:Welcome to the future, Holmesy. It’s not about hacking computers anymore; it’s about hacking human souls. ~ John Green,

54:When land and its tillage are the basis of taxation, one need not care exactly how many people there are. ~ Ian Hacking,

55:If you were just intent on killing people you could do better with a bomb made of agricultural fertiliser. ~ Ian Hacking,

56:Many modern philosophers claim that probability is relation between an hypothesis and the evidence for it. ~ Ian Hacking,

57:Until the seventeenth century there was no concept of evidence with which to pose the problem of induction! ~ Ian Hacking,

58:I don't want anyone hacking us. And I'm not only talking about countries. I'm talking about anyone, period. ~ Donald Trump,

59:For every thousand hacking at the leaves of evil, there is one striking at the root.” We can only achieve ~ Stephen R Covey,

60:Hacking is very interesting. Once they hack, if you don't catch them in the act, you're not going to catch them. ~ Donald Trump,

61:In the words of Thoreau, “For every thousand hacking at the leaves of evil, there is one striking at the root. ~ Stephen R Covey,

62:Artemis felt like he was six again and caught hacking the school computers trying to make the test questions harder ~ Eoin Colfer,

63:Kate had never met a person she didn't want to protect, preferably by hacking at the hostile parties with her sword. ~ Ilona Andrews,

64:Hacking into a victim of crime's phone is a sort of poetically elegant manifestation of a modus operandi the tabloids have. ~ Steve Coogan,

65:The intent of the individuals who created the DDoS attacks has nothing to do with hacking, and they are vandals, not hackers. ~ Kevin Mitnick,

66:Any given study seems to prove a lot, but put together, they are so at odds with each other that the net effect is inconclusive. ~ Ian Hacking,

67:I went to prison for my hacking. Now people hire me to do the same things I went to prison for, but in a legal and beneficial way. ~ Kevin D Mitnick,

68:The administration [of Barack Obama] is going to have to figure out, you know, a tough response on the basis of this [Russian] hacking. ~ John Kasich,

69:Every once in a while, something happens to you that makes you realise that the human race is not quite as bad as it so often seems to be. ~ Ian Hacking,

70:China is stealing our intellectual property, our patents, our designs, our technology, hacking into our computers, counterfeiting our goods. ~ Mitt Romney,

71:Governments almost never admit to hacking each other’s computers. Researchers generally infer the country of origin from the target list. ~ Bruce Schneier,

72:It's clear why hacking communities are [growing]. Because it's like, there's a lot more gold there. There's a lot more to steal than ever before. ~ Tim Cook,

73:Plucking your hair and collecting your snot and nail clippings is one thing, but hacking off a finger to make a damned puppet is insane ~ Michael R Fletcher,

74:the very phenomenon being investigated may be changed by the inquiry itself. It is as if there were a principle of human indeterminacy at work. ~ Ian Hacking,

75:hacking in its pure form stretched back centuries. It wasn't restricted to a single medium. It was more than a methodology. It was an ethos. ~ Robin Wasserman,

76:A single observation that is inconsistent with some generalization points to the falsehood of the generalization, and thereby 'points to itself'. ~ Ian Hacking,

77:Women, on the other hand, had to wield their intellects like a scythe, hacking away against the stubborn underbrush of low expectations. ~ Margot Lee Shetterly,

78:I am not a wishing well with legs. (Paraphrasing Babylon 5's Londo Mollari, repeately, when asked to perform hacking functions for strangers.) ~ Adri n Lamo,

79:We contacted the FBI months ago, when the DNC issue came about. They've reviewed all of our systems. We have hacking detection systems in place. ~ Reince Priebus,

80:My actions constituted pure hacking that resulted in relatively trivial expenses for the companies involved, despite the government's false claims. ~ Kevin Mitnick,

81:The smartest hackers understand that their skill at hacking technology may be less important than their skill at hacking the digital marketplace. ~ Douglas Rushkoff,

82:People sometimes ask me if it is a sin in the Church of Emacs to use vi. Using a free version of vi is not a sin; it is a penance. So happy hacking. ~ Richard Stallman,

83:We favor hypotheses for their simplicity and explanatory power, much as the architect of the world might have done in choosing which possibility to create. ~ Ian Hacking,

84:WHAT IS GROWTH HACKING? The end goal of every growth hacker is to build a self-perpetuating marketing machine that reaches millions by itself. —AARON GINN ~ Ryan Holiday,

85:At Google, engineers were offered a class called “Neural Self-Hacking.” An article in Wired magazine referred to meditation as the tech world’s “new caffeine. ~ Dan Harris,

86:I don't even have any good skills. You know like nunchuck skills, bow hunting skills, computer hacking skills. Girls only want boyfriends who have great skills! ~ Jon Heder,

87:A lot of people would enter restricted sites just to say they can, and then log out. Today, everything related to hacking seems to be for monetary gain. ~ Michael Demon Calce,

88:Hackers are breaking the systems for profit. Before, it was about intellectual curiosity and pursuit of knowledge and thrill, and now hacking is big business. ~ Kevin Mitnick,

89:I have this extraordinary curiosity about all subjects of the natural and human world and the interaction between the physical sciences and the social sciences. ~ Ian Hacking,

90:The truth is revealed by removing things that stand in its light, an art not unlike sculpture, in which the artist creates, not by building, but by hacking away. ~ Alan Watts,

91:In the hacking world, security is more of a response than a proactive measure. They wait for hackers to attack and then they patch, based on the attacks. ~ Michael Demon Calce,

92:Pigpen crosses his arms over his chest, clearly pissed that I'm not following his set of rules for hacking. "You should have come to me when you hit that snag. ~ Katie McGarry,

93:From any vocabulary of ideas we can build other ideas by formal combinations of signs. But not any set of ideas will be instructive. One must have the right ideas. ~ Ian Hacking,

94:A 2014 conference on hacking in Las Vegas. The private sector spent $665 million on data loss prevention last year, according to the technology research firm Gartner. ~ Anonymous,

95:Randy was forever telling people, without rancor, that they were full of shit. That was the only way to get anything done in hacking. No one took it personally. ~ Neal Stephenson,

96:There are two ways in which a science develops; in response to problems which is itself creates, and in response to problems that are forced on it from the outside. ~ Ian Hacking,

97:We'll just have to meet him off campus," I said. "Do your hacker thing and get a hold of him." Chloe rolled her eyes. "It's called a phone. No hacking required. ~ Alyxandra Harvey,

98:I hope that this [hacking] does not continue to be viewed purely through a partisan lens.I think there are Republicans as well as Democrats who are concerned about this. ~ Barack Obama,

99:using playful cleverness to achieve a goal.” Hacking away at something in small chunks or reprogramming bits and pieces of the media is what will define the future of media. ~ Mitch Joel,

100:If somebody's hacking you, you don't want them to know that you know. You want to find out what they're doing, how they're doing it, and then you'll let them know you know. ~ Nancy Pelosi,

101:I have told people that writing this book has been like brushing away dirt from a fossil. What a load of shit. It has been like hacking away at a freezer with a screwdriver. ~ Amy Poehler,

102:I was addicted to hacking, more for the intellectual challenge, the curiosity, the seduction of adventure; not for stealing, or causing damage or writing computer viruses. ~ Kevin Mitnick,

103:With growth hacking, we begin by testing until we can be confident we have a product worth marketing. Only then do we chase the big bang that kick-starts our growth engine. ~ Ryan Holiday,

104:There is no canonical way to think of our own past. In the endless quest for order and structure, we grasp at whatever picture is floating by and put our past into its frame. ~ Ian Hacking,

105:At any time, people suffering severe psychological distress that is not of organic or other biological origin "choose" from socially available and clinically reinforced modes. ~ Ian Hacking,

106:We want to protect American interests. It's America first. I don't want the D.N.C. hacked. I don't want anybody hacked. But I don't know who did the hacking. That's my point. ~ Reince Priebus,

107:I think something will soon have to be done to protect people from hacking and blogging and lying and spreading rumors and chasing you down the street. Lives are wrecked that way. ~ Ali MacGraw,

108:In hacking, like painting, work comes in cycles. Sometimes you get excited about a new project and you want to work sixteen hours a day on it. Other times nothing seems interesting. ~ Paul Graham,

109:An amazing thing about our digital age is that the person next to you at Starbucks might just be hacking into a Swiss bank or launching multiwarhead nuclear missiles continents away. ~ Scott Berkun,

110:Which [the cyber hacking] is why one of the first things we must do is to enforce all classification rules and to enforce all laws relating to the handling of classified information. ~ Donald Trump,

111:I still am mystified about why Donald Trump is out there tweeting praise of Vladimir Putin, and still kind of denying and dismissing whether the hacking happened or the seriousness of it. ~ David Corn,

112:The truth is revealed by removing things that stand in its light, an art not unlike sculpture, in which the artist creates, not by building, but by hacking away. ~ Alan Watts, The Wisdom of Insecurity,

113:While there were many factors in the 2016 election, from false news to voter suppression and Russian hacking, the question is why so many people responded to Donald Trump's demagoguery. ~ Riane Eisler,

114:Perplexity isn’t as noble as conviction, but perhaps more good is done in the name of muddling through uncertainty than is done hacking away with the righteous sword of self-confidence. ~ Gregory Maguire,

115:I'm interested to see what happens with Fox News and phone hacking. I really can't believe it just happens in Great Britain. Because really, who cares about just hacking phones over there? ~ Michael Moore,

116:I’m not going to be able to sleep a wink tonight. I hate shelters. People coughing and snoring and hacking up who-knows-what. It’s a nightmare. But I do have clean teeth. ~ Wendelin Van Draanen,

117:Watching a documentary with people hacking their way through some polar wasteland is merely a visual. Actually trying to deal with cold that can literally kill you is quite a different thing. ~ Henry Rollins,

118:Listen up. Let me tell you something. A man ain’t a goddamn ax. Chopping, hacking, busting every goddamn minute of the day. Things get to him. Things he can’t chop down because they’re inside. ~ Toni Morrison,

119:had believed—until the past couple of weeks—that the world was his personal puzzle, and that any riddlings and unravelings he could perform, including computer hacking, were simply part of his nature. ~ Greg Bear,

120:You always start with a fantasy. Part of the fantasy technique is to visualize something as perfect. Then with the experiments you work back from the fantasy to reality, hacking away at the components. ~ Edwin Land,

121:My parents may never recover from the trauma of having to ask me to put my hacking skills to good use after dissuading me from using them all these years. —from the journal of Payton Marcus Townsend ~ J L Langley,

122:I got so passionate about technology. Hacking to me was like a video game. It was about getting trophies. I just kept going on and on, despite all the trouble I was getting into, because I was hooked. ~ Kevin Mitnick,

123:The Russians sought to interfere with the election process - that the cyber hacking that took place by the Russians was part of that campaign, and that they had a clear preference in terms of outcomes. ~ Barack Obama,

124:We can only achieve quantum improvements in our lives as we quit hacking at the leaves of attitude and behavior and get to work on the root, the paradigms from which our attitudes and behaviors flow. ~ Stephen R Covey,

125:A lot of people think Barack Obama should have responded to the Russian hacking of the U.S. elections weeks ago, months ago. So these happened on his watch. There's nothing wrong with him dealing with it. ~ David Brooks,

126:Even I have lied about writing. I have told people that writing this book has been like brushing away dirt from a fossil. What a load of shit. It has been like hacking away at a freezer with a screwdriver. ~ Amy Poehler,

127:It doesn’t matter how many people know about you or how they find out about you. It matters how many sign up. If handing out flyers on the street corner accomplishes that, then consider it growth hacking. ~ Ryan Holiday,

128:There are two basic ways to criticize an argument: ■ Challenge the premises-show that at least one is false. ■ Challenge the reasoning-show that the premises are not a good reason for the conclusion. ~ Ian Hacking,

129:Cutting up fowl to predict the future is, if done honestly and with as little interpretation as possible, a kind of randomization. But chicken guts are hard to read and invite flights of fancy or corruption. ~ Ian Hacking,

130:Thers is this wonderful iconoclast at Rutgers, Doron Zeilberger, who says that our mathematics is the result of a random walk, by which he means what WE call mathematics. Likewise, I think, for the sciences. ~ Ian Hacking,

131:If you want to test a woman’s capacity to really get shit done, get her sick. You’d be amazed at what a coughing, hacking, feelinglike-hell female can accomplish.” What? They don’t exist? Exactly my point. ~ Jenna McCarthy,

132:Grimly, she realized that clocks don't make a sound that even remotely resembles ticking, tocking. It was more the sound of a hammer, upside down, hacking methodically at the earth. It was the sound of a grave. ~ Markus Zusak,

133:And the conviction stands that there must be knowledge to be had, if only we could get it. Perhaps that is what is wrong: an assumption about the possibility of knowledge and the kind of knowledge that it must be. ~ Ian Hacking,

134:I'm still a hacker. I get paid for it now. I never received any monetary gain from the hacking I did before. The main difference in what I do now compared to what I did then is that I now do it with authorization. ~ Kevin Mitnick,

135:Why should there be the method of science? There is not just one way to build a house, or even to grow tomatoes. We should not expect something as motley as the growth of knowledge to be strapped to one methodology. ~ Ian Hacking,

136:An interactive debugger is an outstanding example of what is not needed - it encourages trial-and-error hacking rather than systematic design, and also hides marginal people barely qualified for precision programming. ~ Harlan Mills,

137:My brief exchange with Guccifer 2 is six weeks after the hacking of the and publication of the DNC documents, which I'm accused of colluding with him on. In other words, I would need a time machine in order to collude. ~ Roger Stone,

138:When you zap things with light to build quantum computers, you're hacking existing systems. You're hijacking the computation that's already happening in the universe, just like a hacker takes over someone else's computer. ~ Seth Lloyd,

139:Steele’s sources offered one final piece of devastating information. They alleged that Trump’s team had coordinated with Russia on the hacking operation against Clinton. And that the Americans had secretly co-paid for it. ~ Luke Harding,

140:Causes are objects of knowledge, and child abuse could be the cause of an illness only if it was something like what is called a natural kind, a kind of event found in nature and hooked up to other events by laws of nature. ~ Ian Hacking,

141:No one can say that this was the decisive and [Russians hacking ] was what elected [Donald] Trump, but clearly his behavior during the campaign in terms of what he said in the week or two before the election was unacceptable. ~ John Lewis,

142:The NSA was hacking into Chinese networks to help defeat them in a war; China was hacking into American networks mainly to help enrich its economy. What made one form of hacking permissible and the other form intolerable? Even ~ Fred Kaplan,

143:I think [Donald Trump] is going to be inaugurated this week. I have great concerns, and apparently Republicans do as well, and there's going to be an investigation about the role that Russian hacking played in getting him elected. ~ John Lewis,

144:Much early alchemy seems to have been adventure. You heated and mixed and burnt and pounded and to see what would happen. An adventure might suggest an hypothesis that can subsequently be tested, but adventure is prior to theory. ~ Ian Hacking,

145:Everything else just kept picking and picking, hacking away. And nothing was interesting, nothing. The people were restrictive and careful, all alike. And I've got to live with these fuckers for the rest of my life, I thought. ~ Charles Bukowski,

146:Experimental work provides the strongest evidence for scientific realism. This is not because we test hypotheses about entities. It is because entities that in principle cannot be 'observed' are manipulated to produce a new phenomena ~ Ian Hacking,

147:If we get to a point where people in this country feel more affinity with a leader who is an adversary and view the United States and our way of life as a threat to him, then we're gonna have bigger problems than just cyber hacking. ~ Barack Obama,

148:It is not in the marketing industry’s DNA to be any of the following things, which are critical to growth hacking: In-house Lean/efficient Trackable Internal (that is product development) over external (public facing/attention seeking) ~ Ryan Holiday,

149:Many cyberweapons manufacturers sell hacking tools to governments worldwide. For example, FinFisher is an “offensive IT Intrusion solution,” according to the promotional material from the UK and German company that makes it, Gamma Group. ~ Bruce Schneier,

150:This was a big leak that WikiLeaks published, and it was hacking software developed by the CIA and the FBI that was able to leave fingerprints of other countries. So the CIA could hack our election to make it look like the Russians did it. ~ Rush Limbaugh,

151:Our intelligence communities spend a lot of time and effort gathering a lot of strands and a lot of data [on Russian hacking]. There are times where they're very cautious and they say, "We think this is what happened, but we're not certain." ~ Barack Obama,

152:Mike Myatt’s ‘Hacking Leadership’ is a must read… Mike combines insightful yet practical commentary with in the trenches leadership experience few can match. I would highly recommend this text to anyone looking to become a better leader. ~ Vijay Govindarajan,

153:Look, Sage. I don't know much about chemistry or computer hacking or photosynthery, but this is something I've got a lot of experience with." I think he mean photosynthesis, but I didn't correct him. "Use my knowledge. Don't let it go to waste. ~ Richelle Mead,

154:A pathfinder's job is hard enough — blazing trails where there are none, guided by nothing but hearsay and gut. While you're hacking your way through bracken, worrying about lurking beasts, all you can do is hope you had chosen the right direction. ~ Justina Chen,

155:Hackers are unruly. That is the essence of hacking. And it is also the essence of Americanness. It is no accident that Silicon Valley is in America, and not France, or Germany, or England, or Japan. In those countries, people color inside the lines. ~ Paul Graham,

156:It's true, I had hacked into a lot of companies, and took copies of the source code to analyze it for security bugs. If I could locate security bugs, I could become better at hacking into their systems. It was all towards becoming a better hacker. ~ Kevin Mitnick,

157:It’s the same something feared by any ass-kicker who finds himself in medias res, hacking through the thick of it, knee-deep in the dead. He feared that, were he ever to stop, the mind he needed to keep trained on a target might instead turn on him. ~ Kent Russell,

158:With hacking getting more and more sophisticated, the hacking community has gone from the hobbyist in the basement to huge sophisticated companies that are essentially doing this, or groups of people or foreign agents inside and outside the United States. ~ Tim Cook,

159:You... don't have the spine!" he hissed with morbid, sadistic amusement. Unfortunately for him, it was mercy that I lacked, not a spine. I raised my swords high overhead. He stopped laughing when I had finished hacking off his head. ~ Courtney Allison Moulton,

160:At Newsweek, I get paid to meet amazing people and write about subjects that fascinate me: fusion energy, education reform, supercomputing, artificial intelligence, robotics, the rising competitiveness of China, the global threat of state-sponsored hacking. ~ Dan Lyons,

161:It’s actually a smarter crime because imagine if you rob a bank, or you’re dealing drugs. If you get caught you’re going to spend a lot of time in custody. But with hacking, it’s much easier to commit the crime and the risk of punishment is slim to none. ~ Kevin Mitnick,

162:Didn't he come to—to ask you for some magic?" "No, he came to enjoy the view of the Wood," the Dragon said. "Of course he came for magic, and I sent him about his business, which is hacking at enemy knights and not meddling in things he scarcely understands. ~ Naomi Novik,

163:The Trojan war is not and you cannot make it be the War of Good vs. Evil. It’s just a war, a wasteful, useless, needless, stupid, protracted, cruel mess full of individual acts of courage, cowardice, nobility, betrayal, limb-hacking-off, and disembowelment. ~ Ursula K Le Guin,

164:A layer of fine powder coats his skin. “My lungs are turning to concrete,” Rob wheezes, hacking and spitting. “So are my eyes. How do I always get roped into these things?” Avery coughs and pats Rob’s back in sympathy. A poof of dust billows from the contact. ~ Laura Kreitzer,

165:Reports the CIA has concluded that Russian hacking of Democratic emails was aimed at helping Donald Trump defeat Hillary Clinton, a step beyond the intelligence community's earlier finding that Russia was simply trying to cast doubt on the integrity of our elections. ~ Donald Trump,

166:He knew from hacking Human laptops that all their passwords were slight variations on a single theme—either their limited noses kept them ignorant to the threats swirling all around them, or they just couldn’t hold more than a few tidbits in their brains at any one time. ~ Hugh Howey,

167:Computer hacking really results in financial losses and hassles. The objectives of terrorist groups are more serious. That is not to say that cyber groups can't access a telephone switch in Manhattan on a day like 9/11, shut it down, and therefore cause more casualties. ~ Kevin Mitnick,

168:Cyber security will be an issue that I will be absolutely focused on as president. Because whether it's Russia, or China, Iran or North Korea more and more countries are using hacking to steal our information, to use it to their advantage. And we can't let that go on. ~ Hillary Clinton,

169:According to Grandad, being a vegetarian wasn't about just health or cruelty of money or flavor: it was about manners. He said that stealing milk and eggs and honey was enough of a liberty without hacking off someone's leg and then drowning it in gravy. He had a point. ~ Jenny Valentine,

170:A lie is no less a lie because it is a thousand years old. Your undivided church has liked nothing better than persecuting its own members, burning them and hacking them apart when they stood by their own conscience, slashing their bellies open and feeding their guts to dogs. ~ Hilary Mantel,

171:Let's finish with Guccifer. My communication with him is now entirely public. It is benign.Secondarily, the timing of my communication is after, not before, I write a story for Breitbart regarding the hacking. And I never defend him from not being a Russian agent in that piece. ~ Roger Stone,

172:There are a thousand hacking at the branches of evil to one who is striking at the root, and it may be that he who bestows the largest amount of time and money on the needy is doing the most by his mode of life to produce that misery which he strives in vain to relieve. ~ Henry David Thoreau,

173:What the US does is the kind of thing I described in Italy in 1948. Case after case like that, not hacking or spreading rumors in the media; but saying look, we're going to starve you to death or kill you or destroy you unless you vote the way we want. I mean that's what we do. ~ Noam Chomsky,

174:If the AI has (perhaps for safety reasons) been confined to an isolated computer, it may use its social manipulation superpower to persuade the gatekeepers to let it gain access to an Internet port. Alternatively, the AI might use its hacking superpower to escape its confinement. ~ Nick Bostrom,

175:There are proxies, proxy servers on the internet, and this is very typical for hackers to use. They create what are called proxy chains where they gain access to a number of different systems around the world, sometimes by hacking these, and they use them as sort of relay boxes. ~ Edward Snowden,

176:Google did a great job hacking the Web to create search - and then monetizing search with advertising. And Apple did a great job humanizing hardware and software so that formerly daunting computers and applications could become consumer-friendly devices - even a lifestyle brand. ~ Douglas Rushkoff,

177:As soon as the serpent’s body was near enough on the starboard side he jumped on to the bulwark and began hacking at it with all his might. It is true that he accomplished nothing beyond breaking Caspian’s second-best sword into bits, but it was a fine thing for a beginner to have done. ~ C S Lewis,

178:We've seen a departure from the traditional work of the National Security Agency. They've become sort of the national hacking agency, the national surveillance agency. And they've lost sight of the fact that everything they do is supposed to make us more secure as a nation and a society. ~ Edward Snowden,

179:The truth is, writing is this: hard and boring and occasionally great but usually not. Even I have lied about writing. I have told people that writing this book has been like brushing away dirt from a fossil. What a load of shit. It has been like hacking away at a freezer with a screwdriver. ~ Amy Poehler,

180:No matter what calamities befall him in everyday life, the true hacker still needs the pressure and inconvenience of four hours of trudging in wind or rain or sleet or sun (or all of them at once), hacking at a white pellet that seems to have a mind of its own and a lousy sense of direction. ~ Tom O Connor,

181:The truth is, writing is this: hard and boring and occasionally great but usually not. Even I have lied about writing. I have told people that writing this book has been like brushing away dirt from a fossil. What a load of shit. It has been like hacking away at a freezer with a screwdriver. I ~ Amy Poehler,

182:Aandrisks don’t have cloning laws?’ ‘No, we don’t have cloning laws.’ ‘Why?’ ‘Because we don’t do it,’ she snapped. ‘The idea never occurred to us. You know why? Because unlike you people, we think nature works fine on its own without tweaking it and hacking it and – and – oh, this is ridiculous. ~ Becky Chambers,

183:A zero-day exploit is a method of hacking a system. It's sort of a vulnerability that has an exploit written for it, sort of a key and a lock that go together to a given software package. It could be an internet web server. It could be Microsoft Office. It could be Adobe Reader or it could be Facebook. ~ Edward Snowden,

184:I've been frankly very surprised at the intensity of our differences [with Russia]. I mean, between what appears to be hacking of our political system to the aggressive use of nukes on the borders, to these atrocities in Syria and their warnings. I've been very, very surprised at the intensity of all this. ~ John Kasich,

185:Hmm…” Melandre acknowledged the comment, then spun back, yelling at Andrake. “Quit dawdling!” She accessed her son's system and sent a flash of light across his eye-screens. “Didn’t have to do that, mum,” said Andrake as he shoved the hacking wand in his pocket and rubbed his eyes. “I was almost done. ~ Thomas K Carpenter,

186:In the words of Thoreau, “For every thousand hacking at the leaves of evil, there is one striking at the root.” We can only achieve quantum improvements in our lives as we quit hacking at the leaves of attitude and behavior and get to work on the root, the paradigms from which our attitudes and behaviors flow. ~ Stephen R Covey,

187:Both [Quine and Feyerabend] want to revise a version of positivism. Quine started with the Vienna Circle, and Feyerabend with the Copenhagen school of quantum mechanics. Both the Circle and the school have been called children of Ernst Mach; if so, the philosophies of Feyerabend and Quine must be his grandchildren. ~ Ian Hacking,

188:I think this is a scary thing [hacking] that does have to be taken out of a partisan context. And one of the best pieces of news this morning is a joint statement, Senator [Chuck] Schumer, Senator [Harry] Reid for the Democrats,John McCain and Lindsey Graham from the Republicans, saying we have to get to the bottom of this. ~ E J Dionne,

189:I wanted to stop talking about the whole thing. I wanted to talk about the hide and the old days and hacking at the ice and whose turn it was to toss the marble and all that, that was what I wanted to talk about. They were the best days, you could see through them days, as clear as polished glass. But Joe didn't want to. ~ Patrick McCabe,

190:Russia and other countries have been hacking and attempting to attack American institutions for years, that Russia's attack on American elections has been going back for over 50 years. So this is nothing new. And the fact that this particular hack was perpetrated by Russian entities is something that no one is disputing. ~ Reince Priebus,

191:I think cyber security, cyber warfare will be one of the biggest challenges facing the next president, because clearly we're facing at this point two different kinds of adversaries. There are the independent hacking groups that do it mostly for commercial reasons to try to steal information that they can use to make money. ~ Hillary Clinton,

192:It's much easier to become a hacker now. It was a private community before and you had to find your way in, like tumbling down a rabbit hole. Today, there are all-in-one desktops fully equipped with tools pre-built into the operating system, all related to hacking. They are all very powerful tools and free to download. ~ Michael Demon Calce,

193:My mom told me once that money problems sort of sneak up on you. She said it’s like catching a cold. At first you just have a tickle in your throat, and then you have a headache, and then maybe you’re coughing a little. The next thing you know, you have a pile of Kleenexes around your bed and you’re hacking your lungs up. ~ Katherine Applegate,

194:It is hard to write a simple definition of something as varied as hacking, but I think what these activities have in common is playfulness, cleverness, and exploration. Thus, hacking means exploring the limits of what is possible, in a spirit of playful cleverness. Activities that display playful cleverness have "hack value". ~ Richard Stallman,

195:The hacking practice is quite widespread in its own right: one NSA document indicates that the agency has succeeded in infecting at least fifty thousand individual computers with a type of malware called “Quantum Insertion.” One map shows the places where such operations have been performed and the number of successful insertions: ~ Glenn Greenwald,

196:Her lack of technological sophistication is evident in her memoir, What Happened, in which she seems to intimate that her private server in Chappaqua was protected from hacking because it was contained in a home guarded by the Secret Service. Hacking a server is done through the internet, not by breaking the glass in a basement window. ~ James Comey,

197:Growth hacking становится ключевым трендом. Суть его в том, чтобы найти нестандартные подходы, чтобы «хакнуть» сам процесс развития компании, найти оригинальные пути роста, подобно тому, как хакеры взламывают коды программ. Специалисты по Growth Hacking обещают стартапам обеспечить взрывной рост количества пользователей, посещаемости и т.д. ~ Anonymous,

198:Since Hillary Clinton won the popular vote, why are they complaining about the Russians hacking the election? I mean, Hillary wins the popular vote, what more can a hacker do than get you the majority of the popular vote? But yet they're running around complaining about the hackers and they're blaming the Russians for stealing the election. ~ Rush Limbaugh,

199:In the absence of big budgets, start-ups learned how to hack the system to build their companies.”2 Their hacking—which occurred right on my watch—had rethought marketing from the ground up, with none of the baggage or old assumptions. And now, their shortcuts, innovations, and backdoor solutions fly in the face of everything we’ve been taught. ~ Ryan Holiday,

200:American companies spend more than $200 billion each year hacking women's bodies into bits and pieces, urging comparisons between self and other, linking value to air-brushed ideals, and as the girls in my seventh-grade class graduated to high school and beyond, the imagery around us would only grow more specific, more pummeling, more insidious. ~ Caroline Knapp,

201:I don't think I underestimated [Vladimir Putin], but I think that I underestimated the degree to which, in this new information age, it is possible for misinformation for cyber hacking and so forth to have an impact on our open societies, our open systems, to insinuate themselves into our democratic practices in ways that I think are accelerating. ~ Barack Obama,

202:In regard to leaving, your options are limited. Dismemberment is one, but I have a hard time imagining you hacking Cerdewellyn into pieces, even if you had the strength. Bone is…difficult.” She ran her hands through her hair, feeling nervous. Yeah, that’s what’s keeping me from dismembering him, pulling a muscle as I cut through bone. ~ Caroline Hanson,

203:Movies such as 'Citizen Kane' and 'The Front Page' portrayed an era when driven newspapermen would do anything to get a story. The U.K.'s rough-and-tumble Fleet Street remains something of a throwback to that era, as demonstrated by the recent phone-hacking scandal - which led to the demise of yet another century-old paper, the 'News of the World.' ~ Nathan Myhrvold,

204:Biovirus TA TA TA targets organisms, hacking and reprogramming ATGACTTATCCACGGTACATTCAGT cellular DNA to produce more virus virus virus virus virus virus virus virus. Its enzymic cut-and-past recombinant wetware-splicing crosses singularity when retroviral reverse-transcriptase clicks in (enabling ontogenetic DNA-RNA circuitry and endocellular computation). ~ Nick Land,

205:We now self-righteously condemn the sexually abusive male. Feminist critics find a lot of hypocrisy in this stance. It allows us to conceal from ourselves that the man's behavior is only an extreme form of a more commonplace aggression toward women and children that is condoned and even encouraged, both in popular media and within the economic power structure. ~ Ian Hacking,

206:If you do away with [hacking],’ he said, ‘you will do away with all the courage and pluck of the game, and I will be bound to bring over a lot of Frenchmen who would beat you with a week’s practice.’ Sport, he appears to have felt, was about pain, brutality and manliness; without that, if it actually came down to skill, any old foreigner might be able to win. ~ Jonathan Wilson,

207:All I knew about Ireland before I went there was what I learned from watching soap commercials all my life. I was totally misinformed. I thought it was an Irish tradition where you don't even take a shower with your soap - you take your soap for a walk, you compliment the soap for a little while and then, suddenly, you just start hacking it up with a hunting knife. ~ Arj Barker,

208:We couldn't build quantum computers unless the universe were quantum and computing. We can build such machines because the universe is storing and processing information in the quantum realm. When we build quantum computers, we're hijacking that underlying computation in order to make it do things we want: little and/or/not calculations. We're hacking into the universe. ~ Seth Lloyd,

209:Readers like SapphicDerrida, who reeled off statistics and used words like “reify” in their comments, made Ifemelu nervous, eager to be fresh and to impress, so that she began, over time, to feel like a vulture hacking into the carcasses of people’s stories for something she could use. Sometimes making fragile links to race. Sometimes not believing herself. ~ Chimamanda Ngozi Adichie,

210:Sadly, as with so much about history's heroes, it's the spotting of potential fame that's the difficulty, whether it's publishing their poems, hanging their paintings, or buying their old underwear. Think of the great men whose lives passed in penury and hacking coughs due to public unawareness that their littlest possession would end up at Sothebys or the basement at Fort Knox. ~ Alan Coren,

211:Authors pretend their stories were always shiny and perfect and just waiting to be written. The truth is, writing is this: hard and boring and occasionally great but usually not. Even I have lied about writing. I have told people that writing this book has been like brushing away dirt from a fossil. What a load of shit. It has been like hacking away at a freezer with a screwdriver. ~ Amy Poehler,

212:I think Donald Trump should be delegitimized for many reasons. And his response to this hacking is also cause for delegitimization. But to say we should move on, when the bedrock of American democracy, the sanctity of our elections, has been messed with, just raises suspicions. His denial of it happening or its seriousness shows that there is something really amiss from his end of it. ~ David Corn,

213:The bad player is the one who tries to calculate and play with the odds, as if his game, his life, were one of a large number of games. To do so is at best to succumb to another necessity, the necessity of large numbers. The good player does not fool himself, and accepts that there is exactly one chance, which produces by chance the necessity and even the purpose that he experiences. ~ Ian Hacking,

214:A gull planed steeply over their heads, a precarious flash of white against the windy blue sky. The short, hacking cry of a baby seemed to merge seamlessly for a moment with the gull's repetitive wail, as if they were one species. One species, Falkender thought, raucous and scavenging; one species calling out in pain. To be human is to be mixed and miscegenated like this. To be lost. ~ M John Harrison,

215:There are a thousand hacking at the branches of evil to one who is striking at the root, and it may be that he who bestows the largest amount of time and money on the needy is doing the most by his mode of life to produce that misery which he strives in vain to relieve. It is the pious slave-breeder devoting the proceeds of every tenth slave to buy a Sunday's liberty for the rest. Some ~ Henry David Thoreau,

216:We have to remember that at the center of all of this is the hacking, is what the Russians did during our election process, their absolute targeting our democracy. And there's President Donald Trump laughing with them. Sergey Lavrov said they did not talk about the charges against Russia. And you still hear President Trump talking as if this may not be true, others may have hacked, as well. ~ Martha Raddatz,

217:The important thing is to be able to understand anyone who has something useful to say. - There is a general moral here. Be very careful and very clear about what you say. But do not be dogmatic about your own language. Be prepared to express any careful thought in the language your audience will understand. And be prepared to learn from someone who talks a language with which you are not familiar. ~ Ian Hacking,

218:It’s always wonderful to witness the emotional agility that some people with actual feelings can manage, and Vince had just performed a truly acrobatic feat, from concern for my life right to a petty problem he was having at work, all without losing a step. But beyond that, it was interesting in another way. Anderson? Hacking? “Vince, that’s not possible,” I said. “Anderson can barely work his phone. ~ Jeff Lindsay,

219:Most Americans are unaware that Iran’s military has such robust computer-hacking capabilities, but Mobasheri had been one of the leaders of this all-but-unheralded success of the Islamic Republic. He and his team of hackers had broken into American defense networks, and had placed infiltration-agent programs into U.S. wireless companies that had taken years and tens of millions of dollars to clean out. ~ Mark Greaney,

220:Stories become great by hacking your brain. Nothing that happens in fiction matters. The people in fiction are fictional so their triumphs and tragedies have literally no consequence. The death of the yogurt you doomed to a fiery death in your gut acid this morning is finitely more tragic than the "deaths" of Romeo and Juliet. The yogurt was alive and then it died. Romeo and Juliet never lived in the first place. ~ Cory Doctorow,

221:Philosophers of science constantly discuss theories and representation of reality, but say almost nothing about experiment, technology, or the use of knowledge to alter the world. This is odd, because 'experimental method' used to be just another name for scientific method.... I hope [to] initiate a Back-to-Bacon movement, in which we attend more seriously to experimental science. Experimentation has a life of its own. ~ Ian Hacking,

222:The team had the hardest time hacking into the server of the J-2, the Joint Staff’s intelligence directorate. Finally, one of the team members simply called the J-2’s office and said that he was with the Pentagon’s IT department, that there were some technical problems, and that he needed to reset all the passwords. The person answering the phone gave him the existing password without hesitating. The Red Team broke in. ~ Fred Kaplan,

223:He plunged headlong into the tangle, hacking right and left with his curved blade. He saw the red-haired girl huddled in a narrow passageway between two houses. Her garments had been torn to shreds, and her flesh was raked and bruised. She was scrambling to her feet, still clutching the short dagger that had cut down a bandit. But before she could kick clear of her dead captor, another raider saw her and closed in. ~ E Hoffmann Price,

224:The Russian commands sound like the name of the camp commandant. Shishtvanyanov: a gnashing and spluttering collection of ch, sh, tch, shch. We can't understand the actual words, but we sense the contempt. You get used to contempt. After a while the commands just sound like a constant clearing of the throat—coughing, sneezing, nose blowing, hacking up mucus. Trudi Pelikan said: Russian is a language that's caught a cold. ~ Herta M ller,

225:The thing that has disturbed me most about the Russian hacking episode is - and the thing that surprised me most has not been the fact of Russian hacking. The cyber world is full of information gathering, you know, propaganda, et cetera. I have been concerned about the degree to which, in some circles, you've seen people suggest that Vladimir Putin has more credibility than the U.S. government. I think that's something new. ~ Barack Obama,

226:When there is this giant narrative, when there is a singular story out there like there is right now about the Russians hacking the election so that Donald Trump would win - when the media is pumping it and the Democrats are quoting the media and the media's quoting the Democrats and it's just like a giant blanket thrown all over the country - don't believe the story. It's made up! It is a script. I call the daily soap opera. ~ Rush Limbaugh,

227:It's a cultural disability in America that we worship pleasure, leisure, and affluence. I think the church is doubly damned when they use Jesus as a vehicle for achieving all of that. Like, if you give a tithe, He'll make you rich. Why? Are you hacking Him off or something? If you give a tithe, you get rid of ten percent of the root of all evil. You should be giving ninety percent. Cause God can handle money better than we can. ~ Rich Mullins,

228:I don't know who did the hacking [through president election 2016]. The article is based on a lie that the R.N.C. was hacked. So the entire premise of the article is false. The sources are unnamed. And the report was inconclusive.The point is, though, we need to find out more facts about this situation. Then we can make intelligent decisions later, and you and I can have more intelligent conversation about what to do about it. ~ Reince Priebus,

229:While human hacking does not occur via computer code, there are many ways to tinker with the human brain. Certainly drugs can do the tampering. How about cleverly disguised messages, disinformation, propaganda, and the newest method of tampering, fake news? Can these messages act like phishing? And what if one of these messages gains hold? Can these alter your brain? Or how about something as innocuous as food? All of the above. ~ Robert H Lustig,

230:Behind every death lay a set of questions. To move on was to agree to not disturb these questions, to let them settle with the body under the earth. Yet some questions so thoroughly dismantled the terms of your own life, turning away was gravitationally impossible. So she would not be moving on. She would keep disturbing and disturbing. She imagined herself standing over a grave with a shovel and hacking away at the soil. ~ Laura van den Berg,

231:Chloe's fingers flew over her keyboard. I raised an eyebrow at Hunter. "Is she Googling hunter-assholes? I doubt they have their own Web page." Chloe snorted. "You'd be surprised." "She's hacking the school files," Hunter said. "She does it all the time." "Don't they have security for that kind of thing?" Chloe snorted again. "Please." I knew that tone. Connor used it whenever someone called his computer mojo into question. ~ Alyxandra Harvey,

232:What are the people like? Do the women wear plaid skirts, cable-knit sweaters? Are the men in hacking jackets? What’s a hacking jacket?” “They’ve grown comfortable with their money,” I said. “They genuinely believe they’re entitled to it. This conviction gives them a kind of rude health. They glow a little.” “I have trouble imagining death at that income level,” she said. “Maybe there is no death as we know it. Just documents changing hands. ~ Don DeLillo,

233:Don’t you think you should lie down?” Red asked, hacking at the ham just for something to do. “Muriel says I should stay up for as long as possible. She said I’ll be so sick of lying in bed by the end that I’ll want these first few hours back.” “Hours?” Red stopped slicing and looked sideways at her. “How many hours?” “Muriel said her first child made his appearance about twenty-four hours after the first pains.” “Twenty-four hours!” Red yelled. ~ Mary Connealy,

234:I'm tired of my life, my clothes, the things I say. I'm hacking away at the surface, as at some kind of gray ice, trying to break through to what is underneath or I am dead. I can feel the surface trembling—it seems ready to give but it never does. I am uninterested in current events. How can I justify this? How can I explain it? I don't want to have the same vocabulary I've always had. I want something richer, broader, more penetrating and powerful. ~ James Salter,

235:The combination of GNU and Linux created an operating system that has been ported to more hardware platforms, ranging from the world’s ten biggest supercomputers to embedded systems in mobile phones, than any other operating system. “Linux is subversive,” wrote Eric Raymond. “Who would have thought that a world-class operating system could coalesce as if by magic out of part-time hacking by several thousand developers scattered all over the planet, ~ Walter Isaacson,

236:remember one of my teammates was just hacking him apart, digging something out,” one girl told me, “and I realized I was patting his arm, going, ‘It’s okay, it’s okay.’” I asked a student named Matthew whether he would miss his cadaver when the course ended, and he replied that it was actually sad when “just part of him left.” (Halfway through the course, the legs are removed and incinerated to reduce the students’ exposure to the chemical preservatives.) ~ Mary Roach,

237:For those of you unfamiliar with the term "growth hacking," growth hacking focuses exclusively on strategies and tactics (typically in digital marketing) that help grow a business or product.  The concept was first coined by Sean Ellis of Dropbox fame back in 2010 in a blog post. It has since changed the face of startup marketing, with Techcrunch guest writer Aaron Ginn explaining that a growth hacker has a "mindset of data, creativity, and curiosity. ~ Monica Leonelle,

238:I know that the body is smart, and the body is adaptable, and the body will always try to find a way, but we are smarter. We are smarter than our bodies and science has figured out a method, a clumsy method full of hacking and stitching back up, to undo biology and remake it. A messy sewing project that’s designed to circumvent nature, bypass evolution, fix everything that went wrong with your guts somewhere along the way. Because that’s the overall message. ~ Jen Larsen,

239:The power of being a student is not just that it is an extended period of instruction, it also places the ego and ambition in someone else's hands. There is a sort of ego ceiling imposed-one knows that is not better than the "master" he apprentices under. Not even close. You defer to them, you subsume yourself. You cannot fake or bullshit them. An education can't be hacked; there are no shortcuts besides hacking it every single day. If you don't , they drop you. ~ Ryan Holiday,

240:[President Donald Trump ] trusts the CIA. This is about 17 or so unnamed agencies in an unnamed report that based the report on something that is totally false.The RNC was not hacked. And so the report is basically trying to make the case that the RNC was hacked, the DNC was hacked, and the only e-mails that came out were DNC e-mails, so therefore, this is the conclusive report that the Russians or whoever was doing the hacking wanted to unfairly change the election. ~ Reince Priebus,

241:Unfortunately, the coughing drew her attention. "Are you dying or something?" she asked, affecting a perfect sneer as I shook my head. "Well, hacking up a lung out in public isn't all that attractive--just sayin'." My face flamed, but then Benji leaned up and spoke around me. "Um, giving half the class an exhaustive summary every Monday morning--in lurid detail--of how much of an alcoholic skank you are? Isn't all that attractive either. Just sayin'. ~ Tammara Webber,

242:I dump a handful of chocolate chips into the blender. Chocolate fixes everything. Tucking the phone between my ear and shoulder, I put the lid on and flick the blender back on, sort of relishing the hacking noise the chocolate chips make as they whir. “What the heck is that noise?” Amber asks. “Just throwing some carrots into the blender,” I lie. “Oh, good call! I love how carrots add that delicious bit of sweetness,” she says. I roll my eyes. Sweetness my ass. They’re carrots. ~ Lauren Layne,

243:It happened: the first 9/11, it happened on September 11, 1973, in Chile. We did it. Was that interfering or hacking a party? This record is all over the world, constantly overthrowing governments, invading, forcing people to follow what we call democracy, as in the cases I mentioned. As I say, if every charge is accurate, it's a joke, and I'm sure half the world is collapsing in laughter about this, because people outside the United States know it. You don't have to tell people in Chile about the first 9/11. ~ Noam Chomsky,

244:the police in Shanghai began carrying guns during routine patrols for the first time this week as part of a China-wide boost in police firepower following a deadly mass knifing blamed on Xinjiang separatists. Ordinary police in China generally don't carry firearms, and none of the officers patrolling the train station in the southwestern city of Kunming on March 1 was armed when at least five assailants began rapidly hacking at victims with long knives. Before armed reinforcements arrived to subdue the attack, the assailants ~ Anonymous,

245:It is said that the Queen has come to love the Commonwealth, partly because it supplies her with regular cheering crowds of flag-waving picaninnies; and one can imagine that Blair, twice victor abroad but enmired at home, is similarly seduced by foreign politeness. They say he is shortly off to the Congo. No doubt the AK47s will fall silent, and the pangas will stop their hacking of human flesh, and the tribal warriors will all break out in Watermelon smiles to see the big white chief touch down in his big white British taxpayer-funded bird. ~ Boris Johnson,

246:The report also said that there wasn't agreement among the 17 agencies. When the FBI came out - they came out - when there was a conclusion on the DNC, their conclusion was very clear and they made it public. Now, if the CIA or whoever else comes out. But they didn't conclude that it was Russia.I don't care if it's Russia or whoever, they shouldn't - we're going to protect Americans. We don't want these countries or whoever else these people are hacking our country, our parties, our - we protect our Americans. We don't like it. We're against it. ~ Reince Priebus,

247:It becomes obvious that if we want to make relatively minor changes in our lives, we can perhaps appropriately focus on our attitudes and behaviors. But if we want to make significant, quantum change, we need to work on our basic paradigms. In the words of Thoreau, “For every thousand hacking at the leaves of evil, there is one striking at the root.” We can only achieve quantum improvements in our lives as we quit hacking at the leaves of attitude and behavior and get to work on the root, the paradigms from which our attitudes and behaviors flow. ~ Stephen R Covey,

248:Theater of Cruelty means a theater difficult and cruel for myself first of all. And, on the level of performance, it is not the cruelty we can exercise upon each other by hacking at each other’s bodies, carving up our personal anatomies, or, like Assyrian emperors, sending parcels of human ears, noses, or neatly detached nostrils through the mail, but the much more terrible and necessary cruelty which things can exercise against us. We are not free. And the sky can still fall on our heads. And the theater has been created to teach us that first of all. ~ Antonin Artaud,

249:In December 1981, the American-trained Atlacatl Battalion began its systemic execution of over 750 civilians in the Salvadoran village of El Mozote, including hundreds of children under the age of 12. The soldiers were thorough and left only one survivor. At first they stabbed and decapitated their victims, but they turned to machine guns when the hacking grew too tiresome (a decade later, an exhumation team digging through the mass graves found hundreds of bullets with head stamps indicating that the ammunition was manufactured in Lake City, Missouri, for the U.S. government). ~ Greg Grandin,

250:Poet, if you can't grow up, at least grow down. Become a carrot, a parsnip. Even a potato. Let the earth conceal your shame. You mistook the mushrooms in your head for truth. Celebrate the actual beauty of mushrooms. Rejoice in their improbabilities. Accept the shortness of the season. Accept the shortness of your own breath. If you cannot suffer light, learn to engender the dark. The poem as hacking cough, as a croaking in the larynx, as a green discharge from blackened lungs. Poet, if you propose to make poems out of your halloween existence, you must learn to shit pumpkins. ~ Robert Kroetsch,

251:So there are two reasons to embrace what happens. One is that it’s happening to you. It was prescribed for you, and it pertains to you. The thread was spun long ago, by the oldest cause of all. The other reason is that what happens to an individual is a cause of well-being in what directs the world—of its well-being, its fulfillment, of its very existence, even. Because the whole is damaged if you cut away anything—anything at all—from its continuity and its coherence. Not only its parts, but its purposes. And that’s what you’re doing when you complain: hacking and destroying. ~ Marcus Aurelius,

252:When President Nixon was reelected in a landslide in 1972, film critic Pauline Kael famously said in disbelief, “I live in a rather special world. I only know one person who voted for Nixon. Where they are I don’t know. They’re outside my ken. But sometimes when I’m in a theater I can feel them.”14 Her statement has come to symbolize the insulation of the liberal elite, living in a bubble and hearing only the opinions of fellow liberals. It has become known as “Pauline Kael Syndrome” and its most virulent strain has been discovered in late 2016, complete with paranoid delusions of Russian hacking. Liberals ~ Roger Stone,

253:... there was one new metallic monstrosity stacked in one corner that she hadn’t seen the last time she was a visitor to his strange chamber, it appeared to be a mass of hard drives all fused together, but they looked too sophisticated to be merely hard drives. “What on earth is that?” “That’s my Kung Fu,” he said proudly, patting the top of the futuristic-looking stack. “Is that what you wanted to show me?” “No, but it’s impressive, isn’t it?” “If you say so.” Steves sighed and shook his head, so few people could appreciate the intellectual complexity of an almost untraceable hacking device. ~ E A Bucchianeri,

254:Labels such as ‘‘the culture wars,’’ ‘‘the science wars,’’ or ‘‘the Freud wars’’ are now widely used to refer to some of the disagreements that plague contemporary intellectual life ... But I would like to register a gentle protest. Metaphors influence the mind in many unnoticed ways. The willingness to describe fierce disagreement in terms of the metaphors of war makes the very existence of real wars seem more natural, more inevitable, more a part of the human condition. It also betrays us into an insensibility toward the very idea of war, so that we are less prone to be aware of how totally disgusting real wars really are. ~ Ian Hacking,

255:Similarly, to be a hacker you have to get a basic thrill from solving problems, sharpening your skills, and exercising your intelligence. If you aren’t the kind of person that feels this way naturally, you’ll need to become one in order to make it as a hacker. Otherwise you’ll find your hacking energy is sapped by distractions like sex, money, and social approval. (You also have to develop a kind of faith in your own learning capacity — a belief that even though you may not know all of what you need to solve a problem, if you tackle just a piece of it and learn from that, you’ll learn enough to solve the next piece — and so on, until you’re done.) ~ Eric S Raymond,

256:An example of the extent of the FSB and GRU covert cyber collection and exploitation was the exposure of what was most likely a Russian State Security & Navy Intelligence covert operation to monitor, exploit and hack targets within the central United States from Russian merchant ships equipped with advanced hacking hardware and tools. The US Coast guard boarded the merchant ship SS Chem Hydra and in it they found wireless intercept equipment associated with Russian hacking teams. Apparently the vessel had personnel on board who were tasked to collect intelligence on wireless networks and attempt hackings on regional computer networks in the heartland of America.59 ~ Malcolm W Nance,

257:We played checkers," said Czernobog, hacking himself another lump of pot roast. "The young man and me. He won a game, I won a game. Because he won a game, I have agreed to go with him and Wednesday, and help in their madness. And because I won a game, when this is all done, I get to kill the young man, with a blow of a hammer." The two Zoryas nodded gravely. "Such a pity," Zorya Vechernyaya told Shadow. "In my fortune for you, I should have said you would have a long life and a happy one, with many children." "That is why you are a good fortune-teller, said Zorya Utrennyaya. She looked sleepy, as if it were effort for her to be up so late. "You tell the best lies. ~ Neil Gaiman,

258:That’s the failing of most big groups,” Scorpion said. “The big dogs give an order, and nobody underneath gets to question it, they just have to do as they’re told. Kills creativity and makes them vulnerable. That’s what I used to do when I was hacking. I’d find a big company, one that had a huge IT department. I knew that the engineers weren’t making decisions, bookkeepers were, and that meant they’d be at least two years behind on security. Those were the easy scores.” “What about government servers?” Raptor asked. “Three years behind,” Scorpion said. “But the government doesn’t have nearly as much money as a big corporation, and they aren’t trying to hide most of it. ~ John G Hartness,

259:As Chris Milk, an early VR pioneer, explains: You read a book; your brain reads letters printed in ink on paper and transforms that into a world. You watch a movie; you’re seeing imagery inside of a rectangle while you’re sitting inside a room, and your brain translates that into a world. And you connect to this even though you know it’s not real, but because you’re in the habit of suspending disbelief. With virtual reality, you’re essentially hacking the visual-audio system of your brain and feeding it a set of stimuli that’s close enough to the stimuli it expects that it sees it as truth. Instead of suspending your disbelief, you actually have to remind yourself not to believe. ~ Anonymous,

260:first time this week as part of a China-wide boost in police firepower following a deadly mass knifing blamed on Xinjiang separatists. Ordinary police in China generally don't carry firearms, and none of the officers patrolling the train station in the southwestern city of Kunming on March 1 was armed when at least five assailants began rapidly hacking at victims with long knives. Before armed reinforcements arrived to subdue the attack, the assailants were able to kill 29 people and wound more than 140, raising concerns about the safety of crowded public places and fears that militants from the far western region of Xinjiang may seek to strike soft targets farther east. China plans to introduce ~ Anonymous,

261:Perhaps these gigantic unsystematic "systems" of health and justice play an important part in channeling and organizing symptoms and their display. Not only do people of different sex get caught by different systems, but also the functionaries and people with little pieces of authority within these systems work on those whom they catch in order to train them to fit in with expectations. And of course once you are caught by justice or mental health, the easiest thing to do is to behave as you are supposed to-violently or weakly, as the case may be. It becomes second nature. That is a traditional suggestion of labeling theory: people adapt their natures to the labels assigned to them by authority. ~ Ian Hacking,

262:Hacking? Some programmers try to hack their way toward working code rather than using a systematic approach like the PPP. If you've ever found that you've coded yourself into a corner in a routine and have to start over, that's an indication that the PPP might work better. If you find yourself losing your train of thought in the middle of coding a routine, that's another indication that the PPP would be beneficial. Have you ever simply forgotten to write part of a class or part of routine? That hardly ever happens if you're using the PPP. If you find yourself staring at the computer screen not knowing where to start, that's a surefire sign that the PPP would make your programming life easier. ~ Steve McConnell,

263:Self knowledge is a virtue in its own right. We value the way in which people can fulfill their own natures by gaining an unsentimental self understanding. We think it is good to grow, for all our vices, into someone who is mature enough to face the past and the present, someone who understands how character, in its weaknesses as well as its strengths, is made of interlocking tendencies and gifts that have grown in the course of a life. The image of growth and maturing is Aristotelian rather than Kantian. These ancient values are ideals that none fully achieve, and yet they are modest, not seeking to find a meaning in life, but finding excellence in living and honoring life and its potentialities. ~ Ian Hacking,

264:Eustace (who had really been trying very hard to behave well, till the rain and the chess put him back) now did the first brave thing he had ever done. He was wearing a sword that Caspian had lent him. As soon as the serpent’s body was near enough on the starboard side he jumped on to the bulwark and began hacking at it with all his might. It is true that he accomplished nothing beyond breaking Caspian’s second-best sword into bits, but it was a fine thing for a beginner to have done. Others would have joined him if at that moment Reepicheep had not called out, “Don’t fight! Push!” It was so unusual for the Mouse to advise anyone not to fight that, even in that terrible moment, every eye turned to him. ~ C S Lewis,

265:With or without his senior advisers, this was the moment for Trump to make the American interest clear—namely, that the Kremlin’s hacking of the election amounted to ill-considered interference. And that any attempt by Moscow to do the same in 2018 or 2020 would lead to a stringent U.S. response—more sanctions, travel bans, even a cutoff of Russia’s access to the SWIFT banking payments system. Putin would interpret anything less than this as American weakness. And, practically, a green light for his operatives to tamper again in Washington’s affairs. All done, of course, under the same cover of plausible deniability. There was no official hacking, the government wasn’t involved, et cetera. Apparently, Trump said none of this. ~ Luke Harding,

266:It amazes me still to this day how quickly the empire fell to pieces. One day the people are kissing the ground upon which the Tsar’s shadow has fallen, the next they are hacking apart his body. Nikolai merely put down his scepter and walked away, and literally overnight a three-hundred-year old dynasty evaporated — poof, gone! — with no one lifting a finger to save it. Ironic that the Soviet Union collapsed just as easily, which proves it was no better, that the cure, kommunizm, was in fact far worse than the disease itself. Now, I can only hope, those days are over, and just maybe that’s true. After all, it took nearly one hundred years for the insanity to fade from France after their revolution. ~ Robert Alexander,

267:I was saying, my dear, that you were clearly born under the baleful influence of Saturn,” said Professor Trelawney, a faint note of resentment in her voice at the fact that he had obviously not been hanging on her words. “Born under — what, sorry?” said Harry. “Saturn, dear, the planet Saturn!” said Professor Trelawney, sounding definitely irritated that he wasn’t riveted by this news. “I was saying that Saturn was surely in a position of power in the heavens at the moment of your birth. . . . Your dark hair . . . your mean stature . . . tragic losses so young in life . . . I think I am right in saying, my dear, that you were born in midwinter?” “No,” said Harry, “I was born in July.” Ron hastily turned his laugh into a hacking cough. ~ J K Rowling,

268:IN 1984, journalist Steven Levy published Hackers: Heroes of the Computer Revolution, which chronicled the scruffy subculture that had not only created the personal computer (and eventually the Internet) but also the unique social ethos that came with it. He listed seven principles of the “hacker ethic”: Access to computers—and anything that might teach you something about the way the world works—should be unlimited and total. Always yield to the Hands-on Imperative! All information should be free. Mistrust authority—promote decentralization. Hackers should be judged by their hacking, not bogus criteria such as degrees, age, race, or position. You can create art and beauty on a computer. Computers can change your life for the better. ~ Chris Anderson,

269:The mind is a machine that is constantly asking: What would I prefer? Close your eyes, refuse to move, and watch what your mind does. What it does is become discontent with That Which Is. A desire arises, you satisfy that desire, and another arises in its place. This wanting and rewanting is an endless cycle for which, turns out, there is already a name: samsara. Samsara is at the heart of the vast human carnival: greed, neurosis, mad ambition, adultery, crimes of passion, the hacking to death of a terrified man on a hillside in the name of A More Pure And Thus Perfect Nation--and all of this takes place because we believe we will be made happy once our desires have been satisfied. I know this. But still I'm full of desire... --"Buddha Boy ~ George Saunders,

270:Something snapped in my mind. The noise all around me receded in a wave until all I heard was a distant, throbbing pulse like a muffled heartbeat. A legionnaire gutted one of the pirates not three strides in front of me, and the man twisted in a horrid dance as his guts spilled. He dropped his weapons—a pair of short, curved swords—and one of them landed at my feet. I picked it up. Through the red mist that drifted down before my eyes, I no longer saw a ship, or pirates. I could see only soldiers. Legionnaires in their uniforms, hacking and slashing and killing. Where the young, arrogant Decurion stood, I saw only a nameless, faceless commander of Caesar’s legions. I saw only the man who’d murdered my sister. In that moment, Caius Varro was Rome. And I . . . I was Vengeance. ~ Lesley Livingston,

271:Everyone lies about writing. They lie about how easy it is or how hard it was. They perpetuate a romantic idea that writing is some beautiful experience that takes place in an architectural room filled with leather novels and chai tea. They talk about their “morning ritual” and how they “dress for writing” and the cabin in Big Sur where they go to “be alone”—blah blah blah. No one tells the truth about writing a book. Authors pretend their stories were always shiny and perfect and just waiting to be written. The truth is, writing is this: hard and boring and occasionally great but usually not. Even I have lied about writing. I have told people that writing this book has been like brushing away dirt from a fossil. What a load of shit. It has been like hacking away at a freezer with a screwdriver. I ~ Amy Poehler,

272:We now have many statistical software packages. Their power is incredible, but the pioneers of statistical inference would have mixed feelings, for they always insisted that people think before using a routine. In the old days routines took endless hours to apply, so one had to spend a lot of time thinking in order to justify using a routine. Now one enters data and presses a button. One result is that people seem to be cowed into not asking silly questions, such as: What hypothesis are you testing? What distribution is it that you say is not normal? What population are you talking about? Where did this base rate come from? Most important of all: Whose judgments do you use to calibrate scores on your questionnaires? Are those judgments generally agreed to by the qualified experts in the entire community? ~ Ian Hacking,

273:Well... there might be a slight problem with the she-devil in your room," she admitted. What! Demon red shimmered before his eye. "Did you harm her?" "What? Sweet lil me? She shook her head, all innocence. "But I may or may not have done some research and come across a bit of info that said hacking off all the her hair would severely weaken her. Then I may or may not have snuck in your bedroom with a pair of scissors and taken these." She lifted her arms and clutched in both her hands were thick hanks of golden hair. "By the way, I may or may not know for a fact that the rumors are definitely not true." Going. To. Kill. Her. "The Red Queen may or may not have woken up mid style job," Anya continued blithely, "and may or may not have taken the scissors away from me and given me a new style of my own. ~ Gena Showalter,

274:Even back then I thought that his uncompromising judgments and unprompted opinions, which he would simply spit out undiplomatically, would put him at odds with a lot of people. There was so much to plan and discuss. I didn’t ask myself back then whether his behavior was normal or not. I didn’t ask myself whether I could trust Julian or whether he might get me in trouble. On the contrary, I was somewhat flattered that he was interested in working with me. For me, Julian Assange was not only the founder of WL but also the hacker known as Mendax, a member of the International Subversives, one of the greatest hackers in the world, and the coauthor/researcher (with Suelette Dreyfus) of Underground: Tales of Hacking, Madness and Obsession from the Electronic Frontier—a highly respected book among connoisseurs. We hit it off right from the start. He ~ Daniel Domscheit Berg,

275:Borderline means you’re one of those girls… …who walk around wearing long sleeves in the summer because you’ve carved up your forearms over your boyfriend. You make pathetic suicidal gestures and write bad poetry about them, listen to Ani DiFranco albums on endless repeat, end up in the emergency room for overdoses, scare off boyfriends by insisting they tell you that they love you five hundred times a day and hacking into their email to make sure they’re not lying, have a police record for shoplifting, and your tooth enamel is eroded from purging. You’ve had five addresses and eight jobs in three years, your friends are avoiding your phone calls, you’re questioning your sexuality, and the credit card companies are after you. It took a lot of years to admit that I was exactly that girl, and that the diagnostic criteria for the disorder were essentially an outline of my life. ~ Stacy Pershall,

276:The sun was warm on my face. I knew we were safe at last. The vast bottle of Champagne, that had sat like some Buddha at base camp for three months, was ceremoniously produced. It took four of us almost ten minutes, hacking away with ice axes, finally to get the cork out. The party had begun. I felt like drinking a gallon of this beautiful bubbly stuff, but my body just couldn’t. Sipping slowly was all I could manage without sneezing, and even like that I was soon feeling decidedly wobbly. I closed my eyes and flopped against the rock wall of the mess tent--a huge smile plastered across my face. Later on in my tent, I put on the fresh socks and thermal underwear that I had kept especially for this moment. First change in ninety days. Heaven. I sealed the underpants in a plastic Ziploc bag and reminded myself to be very cautious when it came to opening the bag again back home. ~ Bear Grylls,

277:A typical plague victim developed large, tumorlike buboes on the skin; they started the size of almonds and grew to the size of eggs. They were painful to the touch and brought on hideous deformities when they grew large. A bubo under the arm would force the arm to lurch uncontrollably out to the side; sited on the neck, it would force the head into a permanently cocked position. The buboes were frequently accompanied by dark blotches, known as God’s tokens, an unmistakable sign that the sufferer had been touched by the angel of death. Accompanying these violent deformities, the victim often developed a hacking cough that brought up blood and developed into incessant vomiting. He gave off a disgusting stench, which seemed to leak from every part of his body—his saliva, breath, sweat, and excrement stank overpoweringly—and eventually he began to lose his mind, wandering around screaming and collapsing in pain. ~ Dan Jones,

278:Rosie flicks out her second knife and takes aim. It spins out of her hand like a star, straight at the Alpha’s chest. But the Alpha knocks it away easily. He raises a clawed hand at my sister and I feel a scream erupting in my throat, recognizing the motion from seven years ago. The swing will take my sister’s eye. I storm through the still-transforming Fenris, swinging my hatchet as if I’m hacking at tree limbs. Rosie’s eyes widen in horror as the Alpha’s claws being to descend. I grit my teeth and force my body forward, now ignoring the other wolves, desperate to reach her. A roaring scream, all human but as fierce as any Fenris howl, echoes through the parking lot. My head snaps to see its source: Silas is running toward Rosie, hunting knives in one hand, axe aloft in the other. His eyes burn brighter than any hellfire. He swings out just as the Alpha’s claws are about to reach Rosie’s face, knocking the monster out of the way. ~ Jackson Pearce,

279:I think Homer outwits most writers who have written on the War, by not taking sides. The Trojan war is not and you cannot make it be the War of Good vs. Evil. It’s just a war, a wasteful, useless, needless, stupid, protracted, cruel mess full of individual acts of courage, cowardice, nobility, betrayal, limb-hacking-off, and disembowelment. Homer was a Greek and might have been partial to the Greek side, but he had a sense of justice or balance that seems characteristically Greek—maybe his people learned a good deal of it from him? His impartiality is far from dispassionate; the story is a torrent of passionate actions, generous, despicable, magnificent, trivial. But it is unprejudiced. It isn’t Satan vs. Angels. It isn’t Holy Warriors vs. Infidels. It isn’t hobbits vs. orcs. It’s just people vs. people. Of course you can take sides, and almost everybody does. I try not to, but it’s no use, I just like the Trojans better than the Greeks. ~ Ursula K Le Guin,

280:You're all Helen talks about. She's been reading Welsh history books and plaguing the family with accounts of Owain Glynd and something called the Eistedfodd." His eyes sparkled with friendly mockery. "Helen was hacking and spitting so much the other day that we thought she was coming down with a cold, until we realized she was practicing the Welsh alphabet." Ordinarily Rhys would have made some sarcastic retort, but he'd barely noticed the gibe. His chest had gone tight with pleasure. "She doesn't have to do that," he muttered. "Helen wants to please you," Devon said. "It's her nature. Which leads to something I want to make clear: Helen is like a younger sister to me. And although I'm obviously the last man alive who should lecture anyone about propriety, I expect you to behave like an altar boy with her for the next few days." Rhys gave him a surly glance. "I *was* an altar boy, and I can tell you that reports of their virtue are highly exaggerated. ~ Lisa Kleypas,

281:Many countries have a long history of spying on foreign corporations for their own military and commercial advantage. The US claims that it does not engage in commercial espionage, meaning that it does not hack foreign corporate networks and pass that information on to US competitors for commercial advantage. But it does engage in economic espionage, by hacking into foreign corporate networks and using that information in government trade negotiations that directly benefit US corporate interests. Recent examples are the Brazilian oil company Petrobras and the European SWIFT international bank payment system. In fact, a 1996 government report boasted that the NSA claimed that the economic benefits of one of its programs to US industry “totaled tens of billions of dollars over the last several years.” You may or may not see a substantive difference between the two types of espionage. China, without so clean a separation between its government and its industries, does not. ~ Bruce Schneier,

282:And my own affairs were as bad, as dismal, as the day I had been born. The only difference was that now I could drink now and then, though never often enough. Drink was the only thing that kept a man from feeling forever stunned and useless. Everything else just kept picking and picking, hacking away. And nothing was interesting, nothing. The people were restrictive and careful, all alike. And I've got to live with these fuckers for the rest of my life, I thought. God, they all had assholes and sexual organs and their mouths and their armpits. They shit and they chattered and they were dull as horse dung. The girls looked good from a distance, the sun shining through their dresses, their hair. But get up close and listen to their minds running out of their mouths, you felt like digging in under a hill and hiding out with a tommy-gun. I would certainly never be able to be happy, to get married, I could never have children. Hell, I couldn't even get a job as a dishwasher. ~ Charles Bukowski,

283:Women, on the other hand, had to wield their intellects like a scythe, hacking away against the stubborn underbrush of low expectations. A woman who worked in the central computing pools was one step removed from the research, and the engineers’ assignments sometimes lacked the context to give the computer much knowledge about the afterlife of the numbers that bedeviled her days. She might spend weeks calculating a pressure distribution without knowing what kind of plane was being tested or whether the analysis that depended on her math had resulted in significant conclusions. The work of most of the women, like that of the Friden, Marchant, or Monroe computing machines they used, was anonymous. Even a woman who had worked closely with an engineer on the content of a research report was rarely rewarded by seeing her name alongside his on the final publication. Why would the computers have the same desire for recognition that they did? many engineers figured. They were women, after all. As ~ Margot Lee Shetterly,

284:The debate was long and furious but, after a fifth meeting at the Freemason’s Tavern in Lincoln’s Inn Fields in London, at 7:00 p.m. on December 8, 1863, carrying the ball by hand was outlawed, and soccer and rugby went their separate ways. The dispute, strangely, was not over the use of the hand but over hacking; that is, whether kicking opponents in the shins should be allowed. F. W. Campbell of Blackheath was very much in favor. “If you do away with [hacking],” he said, “you will do away with all the courage and pluck of the game, and I will be bound to bring over a lot of Frenchmen who would beat you with a week’s practice.” Sports, he appears to have believed, were about pain, brutality, and manliness; without that, if it actually came down to skill, any old foreigner might be able to win. A joke it may have been, but that his words were part of a serious debate is indicative of the general ethos, even if Blackheath did end up resigning from the association when hacking was eventually outlawed. ~ Jonathan Wilson,

285:To A Summer Poet Yes, the Summer girl is flirting on the beach, With a him. And the damboy is a-climbing for the peach, On the limb; Yes, the bullfrog is a-croaking And the dudelet is a-smoking Cigarettes; And the hackman is a-hacking And the showman is a-cracking Up his pets; Yes, the Jersey 'skeeter flits along the shore And the snapdog-we have heard it o'er and o'er; Yes, my poet, Well we know itKnow the spooners how they spoon In the bright Dollar light Of the country tavern moon; Yes, the caterpillars fall From the trees (we know it all), And with beetles all the shelves Are alive. Please unbuttonhole us-O, Have the grace to let us go, For we know How you Summer poets thrive, By the recapitulation And insistent iteration Of the wondrous doings incident to Life Among Ourselves! So, I pray you stop the fervor and the fuss. For you, poor human linnet, There's a half a living in it, But there's not a copper cent in it for us! ~ Ambrose Bierce,

286:In my experience, the books that tend to flop upon release are those where the author goes into a cave for a year to write it, then hands it off to the publisher for release. They hope for a hit that rarely comes. On the other hand, I have clients who blog extensively before publishing. They develop their book ideas based on the themes that they naturally gravitate toward but that also get the greatest response from readers. (One client sold a book proposal using a screenshot of Google queries to his site.) They test the ideas they’re writing about in the book on their blog and when they speak in front of groups. They ask readers what they’d like to see in the book. They judge topic ideas by how many comments a given post generates, by how many Facebook “shares” an article gets. They put potential title and cover ideas up online to test and receive feedback. They look to see what hot topics other influential bloggers are riding and find ways of addressing them in their book.* The latter achieves PMF; the former never does. One is growth hacking; the other, simply guessing. ~ Ryan Holiday,

287:Dr. Joe Allen had autopsied 3,712 murder victims during his long career as the Dade County coroner, so he had seen more indescribable carnage than perhaps any other human being in the whole United States. Throughout the years Joe Allen had charted South Florida's progress by what lay dead on his steel tables, and he was long past the point of ever being shocked or nauseated. He performed meticulous surgery, kept precise files, and compiled priceless morbidity data which earned him a national reputation. For example, it was Dr. Allen who had determined that Greater Miami had more mutilation-homicides per capita than any other American city, a fact he attributed to the terrific climate. In warm weather, Allen noted, there were no outdoor elements to deter a lunatic from spending six, seven, eight hours hacking away on a victim; try that in Buffalo, and you’d freeze your ass off. After Dr. Allen had presented his findings to a big pathologists' convention, several other Sun Belt coroners had conducted their own studies and confirmed what became known as the Allen Mutilation Theorem. ~ Carl Hiaasen,

288:Cups Of Coffee THE HAGGARD woman with a hacking cough and a deathless love whispers of white flowers ... in your poem you pour like a cup of coffee, Gabriel. The slim girl whose voice was lost in the waves of flesh piled on her bones ... and the woman who sold to many men and saw her breasts shrivel ... in two poems you pour these like a cup of coffee, Francois. The woman whose lips are a thread of scarlet, the woman whose feet take hold on hell, the woman who turned to a memorial of salt looking at the lights of a forgotten city ... in your affidavits, ancient Jews, you pour these like cups of coffee. The woman who took men as snakes take rabbits, a rag and a bone and a hank of hair, she whose eyes called men to sea dreams and shark's teeth ... in a poem you pour this like a cup of coffee, Kip. Marching to the footlights in night robes with spots of blood, marching in white sheets muffling the faces, marching with heads in the air they come back and cough and cry and sneer:... in your poems, men, you pour these like cups of coffee. ~ Carl Sandburg,

289:Everyone lies about writing. They lie about how easy it is or how hard it was. They perpetuate a romantic idea that writing is some beautiful experience that takes place in an architectural room filled with leather novels and chai tea. They talk about their “morning ritual” and how they “dress for writing” and the cabin in Big Sur where they go to “be alone”—blah blah blah. No one tells the truth about writing a book. Authors pretend their stories were always shiny and perfect and just waiting to be written. The truth is, writing is this: hard and boring and occasionally great but usually not. Even I have lied about writing. I have told people that writing this book has been like brushing away dirt from a fossil. What a load of shit. It has been like hacking away at a freezer with a screwdriver. I wrote this book after my kids went to sleep. I wrote this book on subways and on airplanes and in between setups while I shot a television show. I wrote this book from scribbled thoughts I kept in the Notes app on my iPhone and conversations I had with myself in my own head before I went to sleep. I wrote it ugly and in pieces. ~ Amy Poehler,

290:Kusanagi is a leading expert in fourth-generation warfare and cyberbrain combative warfare. As the most heavily mechanized member of Section 9, she is regarded amongst her peers as the best hand-to-hand melee fighter and the most skilled "hacker and net diver." Chief Aramaki described her abilities as "...rarer than 'ESP'; the kind of person that government agencies hire to assassinate without leaving a trace." Classified as "Wizard Class" grey hat, her computer security hacking skills allow her brain–computer interface consciousness to control two-external humanoid "drone"-robots remotely with the ability to move her "ghost" from host to host. Kusanagi repeatedly demonstrates uncanny ability to hack people's wetware protected with military-grade malware protection and counter-measures, allowing her to "see through their eyes," disable their vocal systems, or even take control of their bodies altogether. As a cyborg, Kusanagi is able to perform numerous superhuman feats, such as demonstrating superhuman strength, leaping between skyscrapers, advanced acrobatics, or shooting down a bullet after it was fired at mid-range. ~ Wikipedia, Motoko Kusangi,

291:Noah Kagan, a growth hacker at Facebook, the personal finance service Mint.com (which sold to Intuit for nearly $170 million), and the daily deal site AppSumo (which has more than eight hundred thousand users), explains it simply: “Marketing has always been about the same thing—who your customers are and where they are.”5 What growth hackers do is focus on the “who” and “where” more scientifically, in a more measurable way. Whereas marketing was once brand-based, with growth hacking it becomes metric and ROI driven. Suddenly, finding customers and getting attention for your product are no longer guessing games. But this is more than just marketing with better metrics; this is not just “direct marketing” with a new name. Growth hackers trace their roots back to programmers—and that’s how they see themselves. They are data scientists meets design fiends meets marketers. They welcome this information, process it and utilize it differently, and see it as desperately needed clarity in a world that has been dominated by gut instincts and artistic preference for too long. But they also add a strong acumen for strategy, for thinking big picture, and for leveraging platforms, unappreciated assets, and new ideas. ~ Ryan Holiday,

292:A diamond may be forever, but terrorism, promiscuously funded, will be too. Let's make the connection clearly by tracing the path of the diamond. Diamonds start out in the earth, and eventually that earth is part of a country, like Sierra Leone, Angola, or the Democratic Republic of Congo. In those countries, desperate battles for control have been going on for decades, and the armies that fight the battles finance their ambitions with diamonds. Villagers are forced to mine the diamonds by ruthless rebels who maintain order through terror: by raping women and hacking off the limbs of the children, something, by the way, you never see in the De Beers ads. The rebels then smuggle the diamonds into neighboring dictatorships in exchange for guns and cash. There the diamonds are sold to the highest bidder--whether they be terrorists or "legitimate" dealers--and finally they're laundered in Europe, shipped to America, and end up in jewelry stores where they're purchased by men and given to women in exchange for oral sex. In the feminized world we live in, it's practically national policy that women are more evolved that men--but if that's so, how come they're still so impressed by shiny objects? ~ Bill Maher,

293:But, if you've decided to go out on a limb and kill one, for goodness' sake, be prepared. We all read, with dismay, the sad story of a good woman wronged in south Mississippi who took that option and made a complete mess of the entire thing. See, first she shot him. Well, she saw right off the bat that that was a mistake because then she had this enormous dead body to deal with. He was every bit as much trouble to her dead as he ever had been alive, and was getting more so all the time. So then, she made another snap decision to cut him up in pieces and dispose of him a hunk at a time. More poor planning. First, she didn't have the proper carving utensils on hand and hacking him up proved to be just a major chore, plus it made just this colossal mess on her off-white shag living room carpet. It's getting to be like the Cat in the Hat now, only Thing Two ain't showing up to help with the clean-up. She finally gets him into portable-size portions, and wouldn't you know it? Cheap trash bags. Can anything else possible go wrong for this poor woman? So, the lesson here is obvious--for want of a small chain saw, a roll of Visqueen and some genuine Hefty bags, she is in Parchman Penitentiary today instead of New Orleans, where she'd planned to go with her new boyfriend. Preparation is everything. ~ Jill Conner Browne,

294:Another time we were at work in a trench. The dawn was grey around us; grey was the sky above; grey the snow in the pale light of dawn; grey the rags in which my fellow prisoners were clad, and grey ther faces. I was again conversing silently with my wife, or perhaps I was struggling to find the reason for my sufferings, my slow dying. In a last violent protest against the hopelessness of imminent death, I sensed my spirit piercing through the enveloping gloom. I felt it transcend that hopeless, meaningless world, and from somewhere I heard a victorious 'Yes' in answer to my question of the existence of an ultimate purpose. At that moment a light was lit in a distant farmhouse, which stood on the horizon as if painted there, in the midst of the miserable grey of dawning morning in Bavaria. 'Et lux in tenebris lucet' - and the light shineth in the darkness. For hours I stood hacking at the icy ground. The guard passed by, insulting me, and once again I communed with my beloved. More and more I felt that she was present, that she was with me; I had the feeling that I was able to touch her, able to stretch out my hand and grasp hers. The feeling was very strong: she was there. Then, at that very moment, a bird flew down silently and perched just in front of me, on the heap of soil which I had dug up from the ditch, and looked steadily at me. ~ Viktor E Frankl,

295:Woven deep into the vast communication networks wrapping the globe, we also find evidence of embryonic technological autonomy. The technium contains 170 quadrillion computer chips wired up into one mega-scale computing platform. The total number of transistors in this global network is now approximately the same as the number of neurons in your brain. And the number of links among files in this network (think of all the links among all the web pages of the world) is about equal to the number of synapse links in your brain. Thus, this growing planetary electronic membrane is already comparable to the complexity of a human brain. It has three billion artificial eyes (phone and webcams) plugged in, it processes keyword searches at the humming rate of 14 kilohertz (a barely audible high-pitched whine), and it is so large a contraption that it now consumes 5 percent of the world’s electricity. When computer scientists dissect the massive rivers of traffic flowing through it, they cannot account for the source of all the bits. Every now and then a bit is transmitted incorrectly, and while most of those mutations can be attributed to identifiable causes such as hacking, machine error, or line damage, the researchers are left with a few percent that somehow changed themselves. In other words, a small fraction of what the technium communicates originates not from any of its known human-made nodes but from the system at large. The technium is whispering to itself. ~ Kevin Kelly,

296:Hold on to me!” Tedros yelled, hacking briars with his training sword.Dazed, Agatha clung to his chest as he withstood thorn lashes with moans of pain. Soon he had the upper hand and pulled Agatha from the Woods towards the spiked gates, which glowed in recognition and pulled apart, cleaving a narrow path for the two Evers. As the gates speared shut behind them,Agatha looked up at limping Tedros, crisscrossed with bloody scratches, blue shirt shredded away. “Had a feeling Sophie was getting in through the Woods,” he panted, hauling her up into slashed arms before she could protest. “So Professor Dovey gave me permission to take some fairies and stakeout the outer gates. Should have known you’d be here trying to catch her yourself.” Agatha gaped at him dumbly. “Stupid idea for a princess to take on witches alone,” Tedros said, dripping sweat on her pink dress. “Where is she?” Agatha croaked. “Is she safe?” “Not a good idea for princesses to worry about witches either,” Tedros said, hands gripping her waist. Her stomach exploded with butterflies. “Put me down,” she sputtered— “More bad ideas from the princess.” “Put me down!”Tedros obeyed and Agatha pulled away. “I’m not a princess!” she snapped, fixing her collar. “If you say so,” the prince said, eyes drifting downward.Agatha followed them to her gashed legs, waterfalls of brilliant blood. She saw blood blurring— Tedros smiled. “One . . . two . . . three . . .”She fainted in his arms. “Definitely a princess,” he said. ~ Soman Chainani,

297:Imagine… There’s a roast goose in Hong Kong—Mongkok, near the outskirts of the city, the place looks like any other. But you sink your teeth into the quickly hacked pieces and you know you’re experiencing something special. Layers of what can only be described as enlightenment, one extraordinary sensation after another as the popils of the tongue encounter first the crispy, caramelized skin, then air, then fat—the juicy, sweet yet savory, ever so slightly gamey meat, the fat just barely managing to retain its corporeal form before quickly dematerializing into liquid. These are the kinds of tastes and textures that come with year after year of the same man making the same dish. That man—the one there, behind the counter with the cleaver—hacking roast pork, and roast duck, and roast goose as he’s done since he was a child and as his father did before him. He’s got it right now for sure—and, sitting there at one of the white Formica tables, Cantonese pop songs oozing and occasionally distorting from an undersized speaker, you know it, too. In fact, you’re pretty goddamn sure this is the best roast goose on the whole planet. Nobody is eating goose better than you at this precise moment. Maybe in the whole history of the world there has never been a better goose. Ordinarily, you don’t know if you’d go that far describing a dish—but now, with that ethereal goose fat dribbling down your chin, the sound of perfectly crackling skin playing inside your head to an audience of one, hyperbole seems entirely appropriate. ~ Anthony Bourdain,

298:Yeah, let’s get John here. That way we can stall for a while longer. We can keep on doing nothing for just a little while longer.” Albert said, “Take it easy, Howard.” “Take it easy?” Howard jumped to his feet. “Yeah? Where were you last night, Albert? Huh? Because I didn’t see you out there on the street listening to kids screaming, seeing kids running around hurt and scared and choking, and Edilio and Orc struggling, and Dekka hacking up her lungs and Jack crying and… “You know who couldn’t even take it?” Howard raged. “You know who couldn’t even take what was happening? Orc. Orc, who’s not scared of anything. Orc, who everyone thinks is some kind of monster. He couldn’t take it. He couldn’t…but he did. And where were you, Albert? Counting your money? How about you, Astrid? Praying to Jesus?” Astrid’s throat tightened. She couldn’t breathe. For a moment panic threatened to overwhelm her. She wanted to run from the room, run away and never look back. Edilio got to his feet and put an arm around Howard. Howard allowed it, and then he did something Astrid never thought she would see. Howard buried his face in Edilio’s shoulder and cried, racking sobs. “We’re falling apart,” Astrid whispered for herself alone. But there was no easy escape. Everything Howard had said was true. She could see the truth reflected in Albert’s stunned expression. The two of them, the smart ones, the clever ones, the great defenders of truth and fairness and justice, had done nothing while others had worked themselves to exhaustion. ~ Michael Grant,

299:and at one point they had heard what had sounded mighty like a musket shot which, although not very near, might or might not have been fired in their direction but, they decided, probably had been. Harry clung to this adventure, such as it was, all the more tenaciously when he found that because of his sprained wrist he had missed an adventure at Captainganj. Those of his peers who had escaped with life and limb from the Captainganj parade ground did not seem to be thinking of it as an adventure, those who had managed to escape unhurt were now looking tired and shocked. And they seemed to be having trouble telling Harry what it had been like. Each of them simply had two or three terrible scenes printed on his mind: an Englishwoman trying to say something to him with her throat cut, or a comrade spinning down into a whirl-pool of hacking sepoys, something of that sort. To make things worse, one kept finding oneself about to say something to a friend who was not there to hear it any more. It was hard to make any sense out of what had happened, and after a while they gave up trying. Of the score of subalterns who had managed to escape, the majority had never seen a dead person before . . . a dead English person, anyway . . . one occasionally bumped into a dead native here and there but that was not quite the same. Strangely enough, they listened quite enviously to Harry talking about the musket shot which had “almost definitely” been fired at himself and Fleury. They wished they had had an adventure too, instead of their involuntary glimpse of the abattoir. It ~ J G Farrell,

300:But she was barely listening. “There’s this newish thing from Amazon? Called an AMI—an Amazon Machine Image. Basically it runs a snapshot of an operating system. There are hundreds of them, loaded up and ready to run.” Evan said, “Um.” “Virtual machines,” she explained, with a not-insubstantial trace of irritation. “Okay.” “But the good thing with virtual machines? You hit a button and you have two of them. Or ten thousand. In data centers all over the world. Here—look—I’m replicating them now, requesting that they’re geographically dispersed with guaranteed availability.” He looked but could not keep up with the speed at which things were happening on the screen. Despite his well-above-average hacking skills, he felt like a beginning skier atop a black-diamond run. She was still talking. “We upload all the encrypted data from the laptop to the cloud first, right? Like you were explaining poorly and condescendingly to me back at the motel.” “In hindsight—” “And we spread the job out among all of them. Get Hashkiller whaling away, throwing all these password combinations at it. Then who cares if we get locked out after three wrong password attempts? We just go to the next virtual machine. And the one after that.” “How do you have the hardware to handle all that?” She finally paused, blowing a glossy curl out of her eyes. “That’s what I’m telling you, X. You don’t buy hardware anymore. You rent cycles in the cloud. And the second we’re done, we kill the virtual machines and there’s not a single trace of what we did.” She lifted her hands like a low-rent spiritual guru. “It’s all around and nowhere at the same time.” A sly grin. “Like you. ~ Gregg Hurwitz,

301:Adrian looked over at me again. “Who knows more about male weakness: you or me?” “Go on.” I refused to directly answer the question. “Get a new dress. One that shows a lot of skin. Short. Strapless. Maybe a push-up bra too.” He actually had the audacity to do a quick assessment of my chest. “Eh, maybe not. But definitely some high heels.” “Adrian,” I exclaimed. “You’ve seen how Alchemists dress. Do you think I can really wear something like that?” He was unconcerned. “You’ll make it work. You’ll change clothes or something. But I’m telling you, if you want to get a guy to do something that might be difficult, then the best way is to distract him so that he can’t devote his full brainpower to the consequences.” “You don’t have a lot of faith in your own gender.” “Hey, I’m telling you the truth. I’ve been distracted by sexy dresses a lot.” I didn’t really know if that was a valid argument, seeing as Adrian was distracted by a lot of things. Fondue. T-shirts. Kittens. “And so, what then? I show some skin, and the world is mine?” “That’ll help.” Amazingly, I could tell he was dead serious. “And you’ve gotta act confident the whole time, like it’s already a done deal. Then make sure when you’re actually asking for what you want that you tell him you’d be ‘so, so grateful.’ But don’t elaborate. His imagination will do half the work for you. ” I shook my head, glad we’d almost reached our destination. I didn’t know how much more I could listen to. “This is the most ridiculous advice I’ve ever heard. It’s also kind of sexist too, but I can’t decide who it offends more, men or women.” “Look, Sage. I don’t know much about chemistry or computer hacking or photosynthery, but this is something I’ve got a lot of experience with.” I think he meant photosynthesis, but I didn’t correct him. “Use my knowledge. Don’t let it go to waste. ~ Richelle Mead,

302:Eventually, seven independent inquiries exonerated the climate scientists, finding nothing in the e-mails to discredit their work or the larger consensus on global warming. In the meantime, though, Michael Mann’s life, along with the environmental movement, was plunged into turmoil. Mann was among the scientists most roiled by the mysterious hacking incident. Four words in the purloined e-mails were seized upon as evidence that he was a fraud. In describing his research, his colleagues had praised his use of a “trick” that had helped him “hide the decline.” Mann’s detractors leaped to the conclusion that these words proved that his research was just a “trick” to fool the public and that he had deliberately hidden an actual “decline” in twentieth-century temperatures in order to fake evidence of global warming. The facts, when fully understood, were very different. It was a British colleague, not Mann, who had written the ostensibly damning words, and when examined in context, they were utterly mundane. The “trick” referred to was just a clever technique Mann had devised in order to provide a backup data set. The “decline” in question was a reference to a decline in available information from certain kinds of tree rings after 1961, which had made it hard to have a consistent set of data. Another scientist, not Mann, had found an alternative source of data to compensate for this problem, which was what was meant by “hide the decline.” The only genuinely negative disclosure from the e-mails was that Mann and the other climatologists had agreed among themselves to withhold, rather than share, their research with some of their critics, whom they disparaged. Given the harassment they had been subjected to, their reasoning was understandable, but it violated the customary transparency expected within the scientific community. Other than that, the “Climategate” scandal was, in other words, not one. ~ Jane Mayer,

303:Generally, a mood will run its course in an inteligent man; if a woman doesn't puncture it prematurely, the man will puncture it himself. He will regain his senses somewhere along the way; he will say, "Now wait, we had better think about this." That is, if his wife hasn't said five minutes before, "Now, dear, don't you think we had better think about this?" Because then he won't, of course. If a woman is needling, it is doubly hard for a man to come out of a mood. That intensifies it. A man is really in a kind of travail when he is in a mood. He needs help, not needling, but feminine help. He probably won't thank you for it, but inside he will be awfully grateful. When a woman has to deal with a man in a mood, she generally does the wrong thing. She generally gets her animus out, that nasty thing, and says, "Now, look, this is utter nonsense, stop it. We don't need any more fishline leader." That is just throwing gasoline on the fire. There will be an anima-animus exchange, and all will be lost. The two are in the right hand and in the left hand of the goddess Maya, and you might as well give up for the afternoon. There is, however, a point of genius that a woman can bring forth if she is capable of it and willing to do it. If she will become more feminine than the mood attacking the man , she can dispel it for him. But this is a very, very difficult thing for a woman to do. Her automatic response is to let out the sword of the animus and start hacking away. But if a woman can be patient with a man and not critical, but represent for him a true feminine quality, then, as soon as his sanity is sufficiently back for him to comprehend such subtleties, he will likely come out of his mood. A wife can help a great deal if she will function from her feminine side in this way. She has to have a mature feminity to do this, a femininity that is strong enough to stand in the face of this spurious femininity the man is producing. ~ Robert A Johnson,

304:Lagos, typically for a nonbusinessman, had a fatal flaw: he thought too small. He figured that with a little venture capital, this neurolinguistic hacking could be developed as a new technology that would enable Rife to maintain possession of information that had passed into the brains of his programmers. Which, moral considerations aside, wasn't a bad idea. "Rife likes to think big. He immediately saw that this idea could be much more powerful. He took Lagos's idea and told Lagos himself to buzz off. Then he started dumping a lot of money into Pentecostal churches. He took a small church in Bayview, Texas, and built it up into a university. He took a smalltime preacher, the Reverend Wayne Bedford, and made him more important than the Pope. He constructed a string of self-supporting religious franchises all over the world, and used his university, and its Metaverse campus, to crank out tens of thousands of missionaries, who fanned out all over the Third World and began converting people by the hundreds of thousands, just like St. Louis Bertrand. L. Bob Rife's glossolalia cult is the most successful religion since the creation of Islam. They do a lot of talking about Jesus, but like many selfdescribed Christian churches, it has nothing to do with Christianity except that they use his name. It's a postrational religion. "He also wanted to spread the biological virus as a promoter or enhancer of the cult, but he couldn't really get away with doing that through the use of cult prostitution because it is flagrantly anti-Christian. But one of the major functions of his Third World missionaries was to go out into the hinterlands and vaccinate people -- and there was more than just vaccine in those needles. "Here in the First World, everyone has already been vaccinated, and we don't let religious fanatics come up and poke needles into us. But we do take a lot of drugs. So for us, he devised a means for extracting the virus from human blood serum and packaged it as a drug known as Snow Crash. ~ Neal Stephenson,

305:Isn't there something in Genesis about not looking back? A stupid glance over my shoulder showed her expression relaxing, glad I wasn't taking anything that couldn't be replaced and glad I didn't destroy anything that couldn't be repaired. "Do you care for me, Georgia?" I asked her. "Tell me you don't and I'm out of your life forever." She stood in the driveway with her arms wrapped around herself like she was freezing. "Andre is on his way." "I didn't ask you about no Andre." "He'll be here in a minute." My head hurt, but I pressed her. "It's a yes-or-no question." "Can we talk when Andre gets back? We can-" "Stop talking about him. I want to know if you love me." "Andre…" She said his name one time too many. For what happened next, she would have to take some of the blame. I asked her a simple question and she refused to give me a simple answer. I turned from her and made a sharp left turn, pounding across the yard, feeling the dry grass crunch under my shoes. Six long strides put me at the base of the massive tree. I touched the rough bark, an instant of reflection, to give Old Hickey the benefit of the doubt. But in reality, a hickory tree was a useless hunk of wood. Tall, and that's all. To break the shell of a hickory nut, you needed a hammer and an act of Congress, and even then you needed a screwdriver to get at the meat, which was about as tasty as a clod of limestone. Nobody would ever mourn a hickory tree except Celestial, and maybe Andre. When I was a boy, so little I couldn't manage much more than a George Washington hatcher, Big Roy taught me how to take down a tree. Bend your knees, swing hard and low, follow up with a straight chop. Celestial was crying like the baby we never had, yelping and mewing with every swing. Believe me when I say that I didn't slow my pace, even though my shoulders burned and my arms strained and quivered. With every blow, wedges of fresh wood flew from the wounded trunk peppering my face with hot bites. "Speak up, Georgia," I shouted, hacking at the thick grey bark, experiencing pleasure and power with each stroke. "I asked you if you loved me. ~ Tayari Jones,

306:Yet change is usually stressful, and after a certain age, most people don’t like to change. When you are 16, your entire life is change, whether you like it or not. Your body is changing, your mind is changing, your relationships are changing—everything is in flux. You are busy inventing yourself. By the time you are 40, you don’t want change. You want stability. But in the twenty-first century, you won’t be able to enjoy that luxury. If you try to hold on to some stable identity, some stable job, some stable worldview, you will be left behind, and the world will fly by you. So people will need to be extremely resilient and emotionally balanced to sail through this never-ending storm, and to deal with very high levels of stress. The problem is that it is very hard to teach emotional intelligence and resilience. It is not something you can learn by reading a book or listening to a lecture. The current educational model, devised during the 19th century Industrial Revolution, is bankrupt. But so far we haven’t created a viable alternative. So don’t trust the adults too much. In the past, it was a safe bet to trust adults, because they knew the world quite well, and the world changed slowly. But the 21st century is going to be different. Whatever the adults have learned about economics, politics, or relationships may be outdated. Similarly, don’t trust technology too much. You must make technology serve you, instead of you serving it. If you aren’t careful, technology will start dictating your aims and enslaving you to its agenda. So you have no choice but to really get to know yourself better. Know who you are and what you really want from life. This is, of course, the oldest advice in the book: know thyself. But this advice has never been more urgent than in the 21st century. Because now you have competition. Google, Facebook, Amazon, and the government are all relying on big data and machine learning to get to know you better and better. We are not living in the era of hacking computers—we are living in the era of hacking humans. Once the corporations and governments know you better than you know yourself, they could control and manipulate you and you won’t even realize it. So if you want to stay in the game, you have to run faster than Google. Good luck! ~ Timothy Ferriss,

307:Did the Führer take her (mother) away?” The question surprised them both, and it forced Papa to stand up. He looked at the brown-shirted men taking to the pile of ash with shovels. He could hear them hacking into it. Another lie was growing in his mouth, but he found it impossible to let it out. He said, “I think he might have, yes.” “I knew it.” The words were thrown at the steps and Liesel could feel the slush of anger, stirring hotly in her stomach. “I hate the Führer,” she said. “I hate him.” And Hans Hubermann? What did he do? What did he say? Did he bend down and embrace his foster daughter, as he wanted to? Did he tell her that he was sorry for what was happening to her, to her mother, for what had happened to her brother? Not exactly. He clenched his eyes. Then opened them. He slapped Liesel Meminger squarely in the face. “Don’t ever say that!” His voice was quiet, but sharp. As the girl shook and sagged on the steps, he sat next to her and held his face in his hands. It would be easy to say that he was just a tall man sitting poorpostured and shattered on some church steps, but he wasn’t. At the time, Liesel had no idea that her foster father, Hans Hubermann, was contemplating one of the most dangerous dilemmas a German citizen could face. Not only that, he’d been facing it for close to a year. “Papa?” The surprise in her voice rushed her, but it also rendered her useless. She wanted to run, but she couldn’t. She could take a Watschen from nuns and Rosas, but it hurt so much more from Papa. The hands were gone from Papa’s face now and he found the resolve to speak again. “You can say that in our house,” he said, looking gravely at Liesel’s cheek. “But you never say it on the street, at school, at the BDM, never!” He stood in front of her and lifted her by the triceps. He shook her. “Do you hear me?” With her eyes trapped wide open, Liesel nodded her compliance. It was, in fact, a rehearsal for a future lecture, when all of Hans Hubermann’s worst fears arrived on Himmel Street later that year, in the early hours of a November morning. “Good.” He placed her back down. “Now, let us try …” At the bottom of the steps, Papa stood erect and cocked his arm. Forty-five degrees. “Heil Hitler.” Liesel stood up and also raised her arm. With absolute misery, she repeated it. “Heil Hitler.” It was quite a sight—an eleven-year-old girl, trying not to cry on the church steps, saluting the Führer as the voices over Papa’s shoulder chopped and beat at the dark shape in the background. ~ Markus Zusak,

308:Marc Goodman is a cyber crime specialist with an impressive résumé. He has worked with the Los Angeles Police Department, Interpol, NATO, and the State Department. He is the chief cyber criminologist at the Cybercrime Research Institute, founder of the Future Crime Institute, and now head of the policy, law, and ethics track at SU. When breaking down this threat, Goodman sees four main categories of concern. The first issue is personal. “In many nations,” he says, “humanity is fully dependent on the Internet. Attacks against banks could destroy all records. Someone’s life savings could vanish in an instant. Hacking into hospitals could cost hundreds of lives if blood types were changed. And there are already 60,000 implantable medical devices connected to the Internet. As the integration of biology and information technology proceeds, pacemakers, cochlear implants, diabetic pumps, and so on, will all become the target of cyber attacks.” Equally alarming are threats against physical infrastructures that are now hooked up to the net and vulnerable to hackers (as was recently demonstrated with Iran’s Stuxnet incident), among them bridges, tunnels, air traffic control, and energy pipelines. We are heavily dependent on these systems, but Goodman feels that the technology being employed to manage them is no longer up to date, and the entire network is riddled with security threats. Robots are the next issue. In the not-too-distant future, these machines will be both commonplace and connected to the Internet. They will have superior strength and speed and may even be armed (as is the case with today’s military robots). But their Internet connection makes them vulnerable to attack, and very few security procedures have been implemented to prevent such incidents. Goodman’s last area of concern is that technology is constantly coming between us and reality. “We believe what the computer tells us,” says Goodman. “We read our email through computer screens; we speak to friends and family on Facebook; doctors administer medicines based upon what a computer tells them the medical lab results are; traffic tickets are issued based upon what cameras tell us a license plate says; we pay for items at stores based upon a total provided by a computer; we elect governments as a result of electronic voting systems. But the problem with all this intermediated life is that it can be spoofed. It’s really easy to falsify what is seen on our computer screens. The more we disconnect from the physical and drive toward the digital, the more we lose the ability to tell the real from the fake. Ultimately, bad actors (whether criminals, terrorists, or rogue governments) will have the ability to exploit this trust. ~ Peter H Diamandis,

309:Forever Forever some customer happy to sing along with the supermarket muzak, no matter how hackneyed or crass. Forever the plangent sound of a motorcycle in the early hours, conjuring a world you once had access to. Forever the young couple shutting the front door, leaving to conjecture what their next move may be. Forever the van driver slowing down to check a house number against a delivery invoice. Forever an old boy on a rickety bike with a loyal following of one terrier-type mongrel. Forever the husband skulking outside the boutique while his wife seeks approval from a mirror. Forever the kind who believe in God (a little) and horoscopes (a lot) and cannot resist a buy-one-get-one offer. Forever those with a lump in the throat at every reconciliation scene, the theme music’s pathos never failing to work its way straight to the left atrium of the heart. Forever the cleaning woman tapping the pub window with a coin and the helmeted courier leaning his gob to the intercom. Forever a caller so long on hold she wonders should she redial and brave the bossy touch-tone menu again. Forever a youngster hacking the grass with bat or stick in what serves as a green space near the housing estate. Forever, stopped in her tracks at One Hour Photo, a student smiling indulgently at her recent past. Forever the secretary sprinting with franked mail to the post office, minutes before the closing curtain of steel shutters falls. Forever, from an adjacent window, the commentator’s animated voice as the ball approaches the goal area and lands I don’t believe it ... barely wide. Forever the widower turning up a Viennese polka on the Sunday morning programme and scribbling Slovak Radio Symphony Orchestra on a phone bill. Forever the girl upending the nearly-empty crisp packet and savouring life to the full, to the last salty cheese-and-onion flavoured crumb. Forever the old ladies who smile at babies like politicians and suspect the meter reader may not really be the meter reader. Forever a freckled builder in high-vis jacket swinging his lunch-bag as he clocks in at the chipboard hoarding. Forever the teenagers who can’t pass up a hat display without trying on preposterous headgear in a department store. Forever the tall schoolboy with pony tail and full-length leather coat. And forever the small one, pate shaved almost bald, nursing a cigarette like a sore finger. Forever the sort who texts a request for her boyfriend to the lunchtime show then throws in a greeting to her aunt and uncle, just for the heck. Forever the thickset woman, dragging a shopping trolley, who pauses to rub a lottery scratch card like Aladdin’s lamp. Forever the exasperated mother - hatchback open, hazards flashing, eyes peeled for the traffic police - while her son, packing the drum kit, plays it cool. Forever the laughter fading, a dropped coin spinning to a wobbly stop. Forever life heading about its business in places vaguely familiar like an exweatherwoman’s face, a New Zealand premier’s name. Forever. And ever. All going well. ~ Dennis O'Driscoll,

310:So which theory did Lagos believe in? The relativist or the universalist?" "He did not seem to think there was much of a difference. In the end, they are both somewhat mystical. Lagos believed that both schools of thought had essentially arrived at the same place by different lines of reasoning." "But it seems to me there is a key difference," Hiro says. "The universalists think that we are determined by the prepatterned structure of our brains -- the pathways in the cortex. The relativists don't believe that we have any limits." "Lagos modified the strict Chomskyan theory by supposing that learning a language is like blowing code into PROMs -- an analogy that I cannot interpret." "The analogy is clear. PROMs are Programmable Read-Only Memory chips," Hiro says. "When they come from the factory, they have no content. Once and only once, you can place information into those chips and then freeze it -- the information, the software, becomes frozen into the chip -- it transmutes into hardware. After you have blown the code into the PROMs, you can read it out, but you can't write to them anymore. So Lagos was trying to say that the newborn human brain has no structure -- as the relativists would have it -- and that as the child learns a language, the developing brain structures itself accordingly, the language gets 'blown into the hardware and becomes a permanent part of the brain's deep structure -- as the universalists would have it." "Yes. This was his interpretation." "Okay. So when he talked about Enki being a real person with magical powers, what he meant was that Enki somehow understood the connection between language and the brain, knew how to manipulate it. The same way that a hacker, knowing the secrets of a computer system, can write code to control it -- digital namshubs?" "Lagos said that Enki had the ability to ascend into the universe of language and see it before his eyes. Much as humans go into the Metaverse. That gave him power to create nam-shubs. And nam-shubs had the power to alter the functioning of the brain and of the body." "Why isn't anyone doing this kind of thing nowadays? Why aren't there any namshubs in English?" "Not all languages are the same, as Steiner points out. Some languages are better at metaphor than others. Hebrew, Aramaic, Greek, and Chinese lend themselves to word play and have achieved a lasting grip on reality: Palestine had Qiryat Sefer, the 'City of the Letter,' and Syria had Byblos, the 'Town of the Book.' By contrast other civilizations seem 'speechless' or at least, as may have been the case in Egypt, not entirely cognizant of the creative and transformational powers of language. Lagos believed that Sumerian was an extraordinarily powerful language -- at least it was in Sumer five thousand years ago." "A language that lent itself to Enki's neurolinguistic hacking." "Early linguists, as well as the Kabbalists, believed in a fictional language called the tongue of Eden, the language of Adam. It enabled all men to understand each other, to communicate without misunderstanding. It was the language of the Logos, the moment when God created the world by speaking a word. In the tongue of Eden, naming a thing was the same as creating it. To quote Steiner again, 'Our speech interposes itself between apprehension and truth like a dusty pane or warped mirror. The tongue of Eden was like a flawless glass; a light of total understanding streamed through it. Thus Babel was a second Fall.' And Isaac the Blind, an early Kabbalist, said that, to quote Gershom Scholem's translation, 'The speech of men is connected with divine speech and all language whether heavenly or human derives from one source: the Divine Name.' The practical Kabbalists, the sorcerers, bore the title Ba'al Shem, meaning 'master of the divine name.'" "The machine language of the world," Hiro says. ~ Neal Stephenson,

311:Pilate's Wife's Dream I've quenched my lamp, I struck it in that start Which every limb convulsed, I heard it fall­ The crash blent with my sleep, I saw depart Its light, even as I woke, on yonder wall; Over against my bed, there shone a gleam Strange, faint, and mingling also with my dream. It sunk, and I am wrapt in utter gloom; How far is night advanced, and when will day Retinge the dusk and livid air with bloom, And fill this void with warm, creative ray ? Would I could sleep again till, clear and red, Morning shall on the mountain-tops be spread! I'd call my women, but to break their sleep, Because my own is broken, were unjust; They've wrought all day, and well-earned slumbers steep Their labours in forgetfulness, I trust; Let me my feverish watch with patience bear, Thankful that none with me its sufferings share. Yet, Oh, for light ! one ray would tranquilise My nerves, my pulses, more than effort can; I'll draw my curtain and consult the skies: These trembling stars at dead of night look wan, Wild, restless, strange, yet cannot be more drear Than this my couch, shared by a nameless fear. All black­one great cloud, drawn from east to west, Conceals the heavens, but there are lights below; Torches burn in Jerusalem, and cast On yonder stony mount a lurid glow. I see men stationed there, and gleaming spears; A sound, too, from afar, invades my ears. Dull, measured, strokes of axe and hammer ring From street to street, not loud, but through the night Distinctly heard­and some strange spectral thing 45 Is now upreared­and, fixed against the light Of the pale lamps; defined upon that sky, It stands up like a column, straight and high. I see it all­I know the dusky sign­ A cross on Calvary, which Jews uprear While Romans watch; and when the dawn shall shine Pilate, to judge the victim will appear, Pass sentence­yield him up to crucify; And on that cross the spotless Christ must die. Dreams, then, are true­for thus my vision ran; Surely some oracle has been with me, The gods have chosen me to reveal their plan, To warn an unjust judge of destiny: I, slumbering, heard and saw; awake I know, Christ's coming death, and Pilate's life of woe. I do not weep for Pilate­who could prove Regret for him whose cold and crushing sway No prayer can soften, no appeal can move; Who tramples hearts as others trample clay, Yet with a faltering, an uncertain tread, That might stir up reprisal in the dead. Forced to sit by his side and see his deeds; Forced to behold that visage, hour by hour, In whose gaunt lines, the abhorrent gazer reads A triple lust of gold, and blood, and power; A soul whom motives, fierce, yet abject, urge Rome's servile slave, and Judah's tyrant scourge. How can I love, or mourn, or pity him ? I, who so long my fettered hands have wrung; I, who for grief have wept my eye-sight dim; Because, while life for me was bright and young, He robbed my youth­he quenched my life's fair ray­ He crushed my mind, and did my freedom slay. 46 And at this hour­although I be his wife­ He has no more of tenderness from me Than any other wretch of guilty life; Less, for I know his household privacy­ I see him as he is­without a screen; And, by the gods, my soul abhors his mien ! Has he not sought my presence, dyed in blood­ Innocent, righteous blood, shed shamelessly ? And have I not his red salute withstood ? Aye,­when, as erst, he plunged all Galilee In dark bereavement­in affliction sore, Mingling their very offerings with their gore. Then came he­in his eyes a serpent-smile, Upon his lips some false, endearing word, And, through the streets of Salem, clanged the while, His slaughtering, hacking, sacrilegious sword­ And I, to see a man cause men such woe, Trembled with ire­I did not fear to show. And now, the envious Jewish priests have brought Jesus­whom they in mockery call their king­ To have, by this grim power, their vengeance wrought; By this mean reptile, innocence to sting. Oh ! could I but the purposed doom avert, And shield the blameless head from cruel hurt! Accessible is Pilate's heart to fear, Omens will shake his soul, like autumn leaf; Could he this night's appalling vision hear, This just man's bonds were loosed, his life were safe, Unless that bitter priesthood should prevail, And make even terror to their malice quail. Yet if I tell the dream­but let me pause. What dream ? Erewhile the characters were clear, Graved on my brain­at once some unknown cause Has dimmed and rased the thoughts, which now appear, Like a vague remnant of some by-past scene;­ Not what will be, but what, long since, has been. 47 I suffered many things, I heard foretold A dreadful doom for Pilate,­lingering woes, In far, barbarian climes, where mountains cold Built up a solitude of trackless snows, There, he and grisly wolves prowled side by side, There he lived famished­there methought he died; But not of hunger, nor by malady; I saw the snow around him, stained with gore; I said I had no tears for such as he, And, lo ! my cheek is wet­mine eyes run o'er; I weep for mortal suffering, mortal guilt, I weep the impious deed­the blood self-spilt. More I recall not, yet the vision spread Into a world remote, an age to come­ And still the illumined name of Jesus shed A light, a clearness, through the enfolding gloom­ And still I saw that sign, which now I see, That cross on yonder brow of Calvary. What is this Hebrew Christ ? To me unknown, His lineage­doctrine­mission­yet how clear, Is God-like goodness, in his actions shewn ! How straight and stainless is his life's career ! The ray of Deity that rests on him, In my eyes makes Olympian glory dim. The world advances, Greek, or Roman rite Suffices not the inquiring mind to stay; The searching soul demands a purer light To guide it on its upward, onward way; Ashamed of sculptured gods­Religion turns To where the unseen Jehovah's altar burns. Our faith is rotten­all our rites defiled, Our temples sullied, and methinks, this man, With his new ordinance, so wise and mild, Is come, even as he says, the chaff to fan 48 And sever from the wheat; but will his faith Survive the terrors of to-morrow's death ? ***** I feel a firmer trust­a higher hope Rise in my soul­it dawns with dawning day; Lo ! on the Temple's roof­on Moriah's slope Appears at length that clear, and crimson ray, Which I so wished for when shut in by night; Oh, opening skies, I hail, I bless your light ! Part, clouds and shadows ! glorious Sun appear ! Part, mental gloom ! Come insight from on high ! Dusk dawn in heaven still strives with daylight clear, The longing soul, doth still uncertain sigh. Oh ! to behold the truth­that sun divine, How doth my bosom pant, my spirit pine ! This day, time travails with a mighty birth, This day, Truth stoops from heaven and visits earth, Ere night descends, I shall more surely know What guide to follow, in what path to go; I wait in hope­I wait in solemn fear, The oracle of God­the sole­true God­to hear. ~ Charlotte Brontë,

312:The Four Brothers MAKE war songs out of these; Make chants that repeat and weave. Make rhythms up to the ragtime chatter of the machine guns; Make slow-booming psalms up to the boom of the big guns. Make a marching song of swinging arms and swinging legs, Going along, Going along, On the roads from San Antonio to Athens, from Seattle to BagdadThe boys and men in winding lines of khaki, the circling squares of bayonet points. Cowpunchers, cornhuskers, shopmen, ready in khaki; Ballplayers, lumberjacks, ironworkers, ready in khaki; A million, ten million, singing, 'I am ready.' This the sun looks on between two seaboards, In the land of Lincoln, in the land of Grant and Lee. I heard one say, 'I am ready to be killed.' I heard another say, 'I am ready to be killed.' O sunburned clear-eyed boys! I stand on sidewalks and you go by with drums and guns and bugles, You-and the flag! And my heart tightens, a fist of something feels my throat When you go by, You on the kaiser hunt, you and your faces saying, 'I am ready to be killed.' They are hunting death, Death for the one-armed mastoid kaiser. They are after a Hohenzollern head: There is no man-hunt of men remembered like this. The four big brothers are out to kill. France, Russia, Britain, AmericaThe four republics are sworn brothers to kill the kaiser. Yes, this is the great man-hunt; And the sun has never seen till now Such a line of toothed and tusked man-killers, In the blue of the upper sky, 415 In the green of the undersea, In the red of winter dawns. Eating to kill, Sleeping to kill, Asked by their mothers to kill, Wished by four-fifths of the world to killTo cut the kaiser's throat, To hack the kaiser's head, To hang the kaiser on a high-horizon gibbet. And is it nothing else than this? Three times ten million men thirsting the blood Of a half-cracked one-armed child of the German kings? Three times ten million men asking the blood Of a child born with his head wrong-shaped, The blood of rotted kings in his veins? If this were all, O God, I would go to the far timbers And look on the gray wolves Tearing the throats of moose: I would ask a wilder drunk of blood. Look! It is four brothers in joined hands together. The people of bleeding France, The people of bleeding Russia, The people of Britain, the people of AmericaThese are the four brothers, these are the four republics. At first I said it in anger as one who clenches his fist in wrath to fling his knuckles into the face of some one taunting; Now I say it calmly as one who has thought it over and over again at night, among the mountains, by the seacombers in storm. I say now, by God, only fighters to-day will save the world, nothing but fighters will keep alive the names of those who left red prints of bleeding feet at Valley Forge in Christmas snow. On the cross of Jesus, the sword of Napoleon, the skull of Shakespeare, the pen of Tom Jefferson, the ashes of Abraham Lincoln, or any sign of the red and running life poured out by the mothers of the world, By the God of morning glories climbing blue the doors of quiet homes, by the God of tall hollyhocks laughing glad to children in peaceful valleys, by the God of new mothers wishing peace to sit at windows nursing babies, I swear only reckless men, ready to throw away their lives by hunger, 416 deprivation, desperate clinging to a single purpose imperturbable and undaunted, men with the primitive guts of rebellion, Only fighters gaunt with the red brand of labor's sorrow on their brows and labor's terrible pride in their blood, men with souls asking danger-only these will save and keep the four big brothers. Good-night is the word, good-night to the kings, to the czars, Good-night to the kaiser. The breakdown and the fade-away begins. The shadow of a great broom, ready to sweep out the trash, is here. One finger is raised that counts the czar, The ghost who beckoned men who come no moreThe czar gone to the winds on God's great dustpan, The czar a pinch of nothing, The last of the gibbering Romanoffs. Out and good-nightThe ghosts of the summer palaces And the ghosts of the winter palaces! Out and out, good-night to the kings, the czars, the kaisers. Another finger will speak, And the kaiser, the ghost who gestures a hundred million sleeping-waking ghosts, The kaiser will go onto God's great dustpanThe last of the gibbering Hohenzollerns. Look! God pities this trash, God waits with a broom and a dustpan, God knows a finger will speak and count them out. It is written in the stars; It is spoken on the walls; It clicks in the fire-white zigzag of the Atlantic wireless; It mutters in the bastions of thousand-mile continents; It sings in a whistle on the midnight winds from Walla Walla to Mesopotamia: Out and good-night. The millions slow in khaki, The millions learning Turkey in the Straw and John Brown's Body, The millions remembering windrows of dead at Gettysburg, Chickamauga, and Spottsylvania Court House, The millions dreaming of the morning star of Appomattox, 417 The millions easy and calm with guns and steel, planes and prows: There is a hammering, drumming hell to come. The killing gangs are on the way. God takes one year for a job. God takes ten years or a million. God knows when a doom is written. God knows this job will be done and the words spoken: Out and good-night. The red tubes will run, And the great price be paid, And the homes empty, And the wives wishing, And the mothers wishing. There is only one way now, only the way of the red tubes and the great price. Well... Maybe the morning sun is a five-cent yellow balloon, And the evening stars the joke of a God gone crazy. Maybe the mothers of the world, And the life that pours from their torsal foldsMaybe it's all a lie sworn by liars, And a God with a cackling laughter says: 'I, the Almighty God, I have made all this, I have made it for kaisers, czars, and kings.' Three times ten million men say: No. Three times ten million men say: God is a God of the People. And the God who made the world And fixed the morning sun, And flung the evening stars, And shaped the baby hands of life, This is the God of the Four Brothers; This is the God of bleeding France and bleeding Russia; This is the God of the people of Britain and America. The graves from the Irish Sea to the Caucasus peaks are ten times a million. The stubs and stumps of arms and legs, the eyesockets empty, the cripples, ten times a million. 418 The crimson thumb-print of this anathema is on the door panels of a hundred million homes. Cows gone, mothers on sick-beds, children cry a hunger and no milk comes in the noon-time or at night. The death-yells of it all, the torn throats of men in ditches calling for water, the shadows and the hacking lungs in dugouts, the steel paws that clutch and squeeze a scarlet drain day by day-the storm of it is hell. But look! child! the storm is blowing for a clean air. Look! the four brothers march And hurl their big shoulders And swear the job shall be done. Out of the wild finger-writing north and south, east and west, over the bloodcrossed, blood-dusty ball of earth, Out of it all a God who knows is sweeping clean, Out of it all a God who sees and pierces through, is breaking and cleaning out an old thousand years, is making ready for a new thousand years. The four brothers shall be five and more. Under the chimneys of the winter time the children of the world shall sing new songs. Among the rocking restless cradles the mothers of the world shall sing new sleepy-time songs. ~ Carl Sandburg,

313:The Roll Of The Kettledrum 'You have the Pyrrhic dance as yet, Where is the Pyrrhic phalanx gone ? Of two such lessons, why forget The nobler and the manlier one ?'—Byron. ONE line of swart profiles, and bearded lips dressing, One ridge of bright helmets, one crest of fair plumes, One streak of blue sword-blades all bared for the fleshing, One row of red nostrils that scent battle-fumes. Forward ! the trumpets were sounding the charge, The roll of the kettledrum rapidly ran, That music, like wild-fire spreading at large, Madden'd the war-horse as well as the man. Forward ! still forward ! we thunder'd along, Steadily yet, for our strength we were nursing ; Tall Ewart, our sergeant, was humming a song, Lance-corporal Black Will was blaspheming and cursing. Open'd their volley of guns on our right, Puffs of grey smoke, veiling gleams of red flame, Curling to leeward, were seen on the height, Where the batteries were posted, as onward we came. Spreading before us their cavalry lay, Squadron on squadron, troop upon troop ; We were so few, and so many were they— Eagles wait calmly the sparrow-hawk's stoop. Forward ! still forward ! steed answering steed Cheerily neigh'd, while the foam flakes were toss'd From bridle to bridle—the top of our speed Was gain'd, but the pride of our order was lost. One was there, leading by nearly a rood, Though we were racing he kept to the fore, Still as a rock in his stirrups he stood, High in the sunlight his sabre he bore. 275 Suddenly tottering, backwards he crash'd, Loudly his helm right in front of us rung ; Iron hoofs thunder'd, and naked steel flash'd Over him—youngest, where many were young. Now we were close to them, every horse striding Madly ;—St. Luce pass'd with never a groan ;— Sadly my master look'd round—he was riding On the boy's right, with a line of his own. Thrusting his hand in his breast or breast pocket, While from his wrist the sword swung by a chain, Swiftly he drew out some trinket or locket, Kiss'd it (I think) and replaced it again. Burst, while his fingers reclosed on the haft, Jarring concussion and earth shaking din, Horse 'counter'd horse, and I reel'd, but he laugh'd, Down went his man, cloven clean to the chin ! Wedged in the midst of that struggling mass, After the first shock, where each his foe singled, Little was seen save a dazzle, like glass In the sun, with grey smoke and black dust intermingled. Here and there redden'd a pistol shot, flashing Through the red sparkle of steel upon steel ! Redder the spark seem'd, and louder the clashing, Struck from the helm by the iron-shod heel ! Over fallen riders, like wither'd leaves strewing Uplands in autumn, we sunder'd their ranks ; Steeds rearing and plunging, men hacking and hewing, Fierce grinding of sword-blades, sharp goading of flanks. Short was the crisis of conflict soon over, Being too good (I suppose) to last long ; Through them we cut, as the scythe cuts the clover, Batter'd and stain'd we emerged from their throng. Some of our saddles were emptied, of course ; 276 To heaven (or elsewhere) Black Will had been carried ! Ned Sullivan mounted Will's riderless horse, His mare being hurt, while ten seconds we tarried. And then we re-formed, and went at them once more, And ere they had rightly closed up the old track, We broke through the lane we had open'd before, And as we went forward e'en so we came back. Our numbers were few, and our loss far from small, They could fight, and, besides, they were twenty to one ; We were clear of them all when we heard the recall, And thus we returned, but my tale is not done. For the hand of my rider felt strange on my bit, He breathed once or twice like one partially choked, And sway'd in his seat, then I knew he was hit :— He must have bled fast, for my withers were soak'd, And scarcely an inch of my housing was dry ; I slacken'd my speed, yet I never quite stopp'd, Ere he patted my neck, said, 'Old fellow, good-bye !' And dropp'd off me gently, and lay where he dropp'd ! Ah, me ! after all, they may call us dumb creatures— I tried hard to neigh, but the sobs took my breath, Yet I guess'd, gazing down at those still, quiet features, He was never more happy in life than in death. ................. Two years back, at Aldershot, Elrington mentioned My name to our colonel one field-day. He said, ' 'Count,' 'Steeltrap,' and 'Challenger' ought to be pension'd ;' 'Count' died the same week, and now 'Steeltrap' is dead. That morning our colonel was riding 'Theresa,' The filly by 'Teddington' out of 'Mistake' ; His girls, pretty Alice and fair-haired Louisa, Were there on the ponies he purchased from Blake. I remember he pointed me out to his daughters, 277 Said he, 'In this troop I may fairly take pride, But I've none left like him in my officers' quarters, Whose life-blood the mane of old 'Challenger' dyed.' Where are they ? the war-steeds who shared in our glory, The 'Lanercost' colt, and the 'Acrobat' mare, And the Irish division, 'Kate Kearney' and 'Rory,' And rushing 'Roscommon,' and eager 'Kildare,' And And And And 'Freeny,' a favourite once with my master, 'Warlock,' a sluggard, but honest and true, 'Tancred,' as honest as 'Warlock,' but faster, 'Blacklock,' and 'Birdlime,' and 'Molly Carew' ?— All vanish'd, what wonder ! twelve summers have pass'd Since then, and my comrade lies buried this day,— Old 'Steeltrap,' the kicker,—and now I'm the last Of the chargers who shared in that glorious fray. ................. Come, 'Harlequin,' keep your nose out of my manger, You'll get your allowance, my boy, and no more ; Snort ! 'Silvertail,' snort ! when you've seen as much danger As I have, you won't mind the rats in the straw. ................. Our gallant old colonel came limping and halting, The day before yesterday, into my stall ; Oh ! light to the saddle I've once seen him vaulting, In full marching order, steel broadsword and all. And now his left leg than his right is made shorter Three inches, he stoops, and his chest is unsound ; He spoke to me gently, and patted my quarter, I laid my ears back and look'd playfully round. For that word kindly meant, that caress kindly given, I thank'd him, though dumb, but my cheerfulness fled ; More sadness I drew from the face of the living Than years back I did from the face of the dead. 278 For the dead face, upturn'd, tranquil, joyous, and fearless, Look'd straight from green sod to blue fathomless sky With a smile ; but the living face, gloomy and tearless, And haggard and harass'd, look'd down with a sigh. Did he think on the first time he kiss'd Lady Mary ? On the morning he wing'd Horace Greville the beau ? On the winner he steer'd in the grand military ? On the charge that he headed twelve long years ago ? Did he think on each fresh year, of fresh grief the herald ? On lids that are sunken, and locks that are grey ? On Alice, who bolted with Brian Fitzgerald ? On Rupert, his first-born, dishonour'd by 'play' ? On Louey, his darling, who sleeps 'neath the cypress, That shades her and one whose last breath gave her life ? I saw those strong fingers hard over each eye press— Oh ! the dead rest in peace when the quick toil in strife ! ................. Scoff, man ! egotistical, proud, unobservant, Since I with man's grief dare to sympathize thus ; Why scoff ?—fellow-creature I am, fellow-servant Of God, can man fathom God's dealings with us ? The wide gulf that parts us may yet be no wider Than that which parts you from some being more blest ; And there may be more links 'twixt the horse and his rider Than ever your shallow philosophy guess'd. You are proud of your power, and vain of your courage, And your blood, Anglo-Saxon, or Norman, or Celt ; Though your gifts you extol, and our gifts you disparage, Your perils, your pleasures, your sorrows we've felt. We, too, sprung from mares of the prophet of Mecca, And nursed on the pride that was born with the milk, And filtered through 'Crucifix,' 'Beeswing,' 'Rebecca,' We love sheen of scarlet and shimmer of silk. 279 We, too, sprung from loins of the Ishmaelite stallions, We glory in daring that dies or prevails ; From 'counter of squadrons, and crash of battalions, To rending of blackthorns, and rattle of rails. In all strife where courage is tested, and power, From the meet on the hill-side, the horn-blast, the find, The burst, the long gallop that seems to devour The champaign, all obstacles flinging behind, To the cheer and the clarion, the war-music blended With war-cry, the furious dash at the foe, The terrible shock, the recoil, and the splendid Bare sword, flashing blue rising red from the blow. I've borne one through perils where many have seen us, No tyrant, a kind friend, a patient instructor, And I've felt some strange element flashing between us, Till the saddle seem'd turn'd to a lightning conductor. Did he see ? could he feel through the faintness, the numbness, While linger'd the spirit half-loosed from the clay, Dumb eyes seeking his in their piteous dumbness, Dumb quivering nostrils, too stricken to neigh ? And what then ? the colours reversed, the drums muffled, The black nodding plumes, the dead march, and the pall, The stern faces, soldier-like, silent, unruffled, The slow sacred music that floats over all ! Cross carbine and boar-spear, hang bugle and banner, Spur, sabre, and snaffle, and helm—Is it well ? Vain 'scutcheon, false trophies of Mars and Diana,— Can the dead laurel sprout with the live immortelle ? It may be,—we follow, and though we inherit Our strength for a season, our pride for a span, Say ! vanity are they ? vexation of spirit ? Not so, since they serve for a time horse and man. They serve for a time, and they make life worth living, 280 In spite of life's troubles—'tis vain to despond ; Oh, man ! we at least, we enjoy, with thanksgiving, God's gifts on this earth, though we look not beyond. You sin, and you suffer, and we, too, find sorrow, Perchance through your sin—yet it soon will be o'er ; We labour to-day, and we slumber to-morrow, Strong horse and bold rider !—and who knoweth more ? ................. In our barrack-square shouted Drill-sergeant M'Cluskie, The roll of the kettledrum rapidly ran, The colonel wheel'd short, speaking once, dry and husky, 'Would to God I had died with your master, old man !' ~ Adam Lindsay Gordon,

314:Sword Blades And Poppy Seed A drifting, April, twilight sky, A wind which blew the puddles dry, And slapped the river into waves That ran and hid among the staves Of an old wharf. A watery light Touched bleak the granite bridge, and white Without the slightest tinge of gold, The city shivered in the cold. All day my thoughts had lain as dead, Unborn and bursting in my head. From time to time I wrote a word Which lines and circles overscored. My table seemed a graveyard, full Of coffins waiting burial. I seized these vile abortions, tore Them into jagged bits, and swore To be the dupe of hope no more. Into the evening straight I went, Starved of a day's accomplishment. Unnoticing, I wandered where The city gave a space for air, And on the bridge's parapet I leant, while pallidly there set A dim, discouraged, worn-out sun. Behind me, where the tramways run, Blossomed bright lights, I turned to leave, When someone plucked me by the sleeve. 'Your pardon, Sir, but I should be Most grateful could you lend to me A carfare, I have lost my purse.' The voice was clear, concise, and terse. I turned and met the quiet gaze Of strange eyes flashing through the haze. The man was old and slightly bent, Under his cloak some instrument Disarranged its stately line, He rested on his cane a fine And nervous hand, an almandine 225 Smouldered with dull-red flames, sanguine It burned in twisted gold, upon His finger. Like some Spanish don, Conferring favours even when Asking an alms, he bowed again And waited. But my pockets proved Empty, in vain I poked and shoved, No hidden penny lurking there Greeted my search. 'Sir, I declare I have no money, pray forgive, But let me take you where you live.' And so we plodded through the mire Where street lamps cast a wavering fire. I took no note of where we went, His talk became the element Wherein my being swam, content. It flashed like rapiers in the night Lit by uncertain candle-light, When on some moon-forsaken sward A quarrel dies upon a sword. It hacked and carved like a cutlass blade, And the noise in the air the broad words made Was the cry of the wind at a window-pane On an Autumn night of sobbing rain. Then it would run like a steady stream Under pinnacled bridges where minarets gleam, Or lap the air like the lapping tide Where a marble staircase lifts its wide Green-spotted steps to a garden gate, And a waning moon is sinking straight Down to a black and ominous sea, While a nightingale sings in a lemon tree. I walked as though some opiate Had stung and dulled my brain, a state Acute and slumbrous. It grew late. We stopped, a house stood silent, dark. The old man scratched a match, the spark Lit up the keyhole of a door, We entered straight upon a floor White with finest powdered sand Carefully sifted, one might stand 226 Muddy and dripping, and yet no trace Would stain the boards of this kitchen-place. From the chimney, red eyes sparked the gloom, And a cricket's chirp filled all the room. My host threw pine-cones on the fire And crimson and scarlet glowed the pyre Wrapped in the golden flame's desire. The chamber opened like an eye, As a half-melted cloud in a Summer sky The soul of the house stood guessed, and shy It peered at the stranger warily. A little shop with its various ware Spread on shelves with nicest care. Pitchers, and jars, and jugs, and pots, Pipkins, and mugs, and many lots Of lacquered canisters, black and gold, Like those in which Chinese tea is sold. Chests, and puncheons, kegs, and flasks, Goblets, chalices, firkins, and casks. In a corner three ancient amphorae leaned Against the wall, like ships careened. There was dusky blue of Wedgewood ware, The carved, white figures fluttering there Like leaves adrift upon the air. Classic in touch, but emasculate, The Greek soul grown effeminate. The factory of Sevres had lent Elegant boxes with ornament Culled from gardens where fountains splashed And golden carp in the shadows flashed, Nuzzling for crumbs under lily-pads, Which ladies threw as the last of fads. Eggshell trays where gay beaux knelt, Hand on heart, and daintily spelt Their love in flowers, brittle and bright, Artificial and fragile, which told aright The vows of an eighteenth-century knight. The cruder tones of old Dutch jugs Glared from one shelf, where Toby mugs Endlessly drank the foaming ale, Its froth grown dusty, awaiting sale. The glancing light of the burning wood 227 Played over a group of jars which stood On a distant shelf, it seemed the sky Had lent the half-tones of his blazonry To paint these porcelains with unknown hues Of reds dyed purple and greens turned blues, Of lustres with so evanescent a sheen Their colours are felt, but never seen. Strange winged dragons writhe about These vases, poisoned venoms spout, Impregnate with old Chinese charms; Sealed urns containing mortal harms, They fill the mind with thoughts impure, Pestilent drippings from the ure Of vicious thinkings. 'Ah, I see,' Said I, 'you deal in pottery.' The old man turned and looked at me. Shook his head gently. 'No,' said he. Then from under his cloak he took the thing Which I had wondered to see him bring Guarded so carefully from sight. As he laid it down it flashed in the light, A Toledo blade, with basket hilt, Damascened with arabesques of gilt, Or rather gold, and tempered so It could cut a floating thread at a blow. The old man smiled, 'It has no sheath, 'Twas a little careless to have it beneath My cloak, for a jostle to my arm Would have resulted in serious harm. But it was so fine, I could not wait, So I brought it with me despite its state.' 'An amateur of arms,' I thought, 'Bringing home a prize which he has bought.' 'You care for this sort of thing, Dear Sir?' 'Not in the way which you infer. I need them in business, that is all.' And he pointed his finger at the wall. Then I saw what I had not noticed before. The walls were hung with at least five score Of swords and daggers of every size Which nations of militant men could devise. 228 Poisoned spears from tropic seas, That natives, under banana trees, Smear with the juice of some deadly snake. Blood-dipped arrows, which savages make And tip with feathers, orange and green, A quivering death, in harlequin sheen. High up, a fan of glancing steel Was formed of claymores in a wheel. Jewelled swords worn at kings' levees Were suspended next midshipmen's dirks, and these Elbowed stilettos come from Spain, Chased with some splendid Hidalgo's name. There were Samurai swords from old Japan, And scimitars from Hindoostan, While the blade of a Turkish yataghan Made a waving streak of vitreous white Upon the wall, in the firelight. Foils with buttons broken or lost Lay heaped on a chair, among them tossed The boarding-pike of a privateer. Against the chimney leaned a queer Two-handed weapon, with edges dull As though from hacking on a skull. The rusted blood corroded it still. My host took up a paper spill From a heap which lay in an earthen bowl, And lighted it at a burning coal. At either end of the table, tall Wax candles were placed, each in a small, And slim, and burnished candlestick Of pewter. The old man lit each wick, And the room leapt more obviously Upon my mind, and I could see What the flickering fire had hid from me. Above the chimney's yawning throat, Shoulder high, like the dark wainscote, Was a mantelshelf of polished oak Blackened with the pungent smoke Of firelit nights; a Cromwell clock Of tarnished brass stood like a rock In the midst of a heaving, turbulent sea Of every sort of cutlery. 229 There lay knives sharpened to any use, The keenest lancet, and the obtuse And blunted pruning bill-hook; blades Of razors, scalpels, shears; cascades Of penknives, with handles of mother-of-pearl, And scythes, and sickles, and scissors; a whirl Of points and edges, and underneath Shot the gleam of a saw with bristling teeth. My head grew dizzy, I seemed to hear A battle-cry from somewhere near, The clash of arms, and the squeal of balls, And the echoless thud when a dead man falls. A smoky cloud had veiled the room, Shot through with lurid glares; the gloom Pounded with shouts and dying groans, With the drip of blood on cold, hard stones. Sabres and lances in streaks of light Gleamed through the smoke, and at my right A creese, like a licking serpent's tongue, Glittered an instant, while it stung. Streams, and points, and lines of fire! The livid steel, which man's desire Had forged and welded, burned white and cold. Every blade which man could mould, Which could cut, or slash, or cleave, or rip, Or pierce, or thrust, or carve, or strip, Or gash, or chop, or puncture, or tear, Or slice, or hack, they all were there. Nerveless and shaking, round and round, I stared at the walls and at the ground, Till the room spun like a whipping top, And a stern voice in my ear said, 'Stop! I sell no tools for murderers here. Of what are you thinking! Please clear Your mind of such imaginings. Sit down. I will tell you of these things.' He pushed me into a great chair Of russet leather, poked a flare Of tumbling flame, with the old long sword, Up the chimney; but said no word. Slowly he walked to a distant shelf, 230 And brought back a crock of finest delf. He rested a moment a blue-veined hand Upon the cover, then cut a band Of paper, pasted neatly round, Opened and poured. A sliding sound Came from beneath his old white hands, And I saw a little heap of sands, Black and smooth. What could they be: 'Pepper,' I thought. He looked at me. 'What you see is poppy seed. Lethean dreams for those in need.' He took up the grains with a gentle hand And sifted them slowly like hour-glass sand. On his old white finger the almandine Shot out its rays, incarnadine. 'Visions for those too tired to sleep. These seeds cast a film over eyes which weep. No single soul in the world could dwell, Without these poppy-seeds I sell.' For a moment he played with the shining stuff, Passing it through his fingers. Enough At last, he poured it back into The china jar of Holland blue, Which he carefully carried to its place. Then, with a smile on his aged face, He drew up a chair to the open space 'Twixt table and chimney. 'Without preface, Young man, I will say that what you see Is not the puzzle you take it to be.' 'But surely, Sir, there is something strange In a shop with goods at so wide a range Each from the other, as swords and seeds. Your neighbours must have greatly differing needs.' 'My neighbours,' he said, and he stroked his chin, 'Live everywhere from here to Pekin. But you are wrong, my sort of goods Is but one thing in all its moods.' He took a shagreen letter case From his pocket, and with charming grace Offered me a printed card. I read the legend, 'Ephraim Bard. Dealer in Words.' And that was all. 231 I stared at the letters, whimsical Indeed, or was it merely a jest. He answered my unasked request: 'All books are either dreams or swords, You can cut, or you can drug, with words. My firm is a very ancient house, The entries on my books would rouse Your wonder, perhaps incredulity. I inherited from an ancestry Stretching remotely back and far, This business, and my clients are As were those of my grandfather's days, Writers of books, and poems, and plays. My swords are tempered for every speech, For fencing wit, or to carve a breach Through old abuses the world condones. In another room are my grindstones and hones, For whetting razors and putting a point On daggers, sometimes I even anoint The blades with a subtle poison, so A twofold result may follow the blow. These are purchased by men who feel The need of stabbing society's heel, Which egotism has brought them to think Is set on their necks. I have foils to pink An adversary to quaint reply, And I have customers who buy Scalpels with which to dissect the brains And hearts of men. Ultramundanes Even demand some finer kinds To open their own souls and minds. But the other half of my business deals With visions and fancies. Under seals, Sorted, and placed in vessels here, I keep the seeds of an atmosphere. Each jar contains a different kind Of poppy seed. From farthest Ind Come the purple flowers, opium filled, From which the weirdest myths are distilled; My orient porcelains contain them all. Those Lowestoft pitchers against the wall Hold a lighter kind of bright conceit; 232 And those old Saxe vases, out of the heat On that lowest shelf beside the door, Have a sort of Ideal, 'couleur d'or'. Every castle of the air Sleeps in the fine black grains, and there Are seeds for every romance, or light Whiff of a dream for a summer night. I supply to every want and taste.' 'Twas slowly said, in no great haste He seemed to push his wares, but I Dumfounded listened. By and by A log on the fire broke in two. He looked up quickly, 'Sir, and you?' I groped for something I should say; Amazement held me numb. 'To-day You sweated at a fruitless task.' He spoke for me, 'What do you ask? How can I serve you?' 'My kind host, My penniless state was not a boast; I have no money with me.' He smiled. 'Not for that money I beguiled You here; you paid me in advance.' Again I felt as though a trance Had dimmed my faculties. Again He spoke, and this time to explain. 'The money I demand is Life, Your nervous force, your joy, your strife!' What infamous proposal now Was made me with so calm a brow? Bursting through my lethargy, Indignantly I hurled the cry: 'Is this a nightmare, or am I Drunk with some infernal wine? I am no Faust, and what is mine Is what I call my soul! Old Man! Devil or Ghost! Your hellish plan Revolts me. Let me go.' 'My child,' And the old tones were very mild, 'I have no wish to barter souls; My traffic does not ask such tolls. I am no devil; is there one? Surely the age of fear is gone. 233 We live within a daylight world Lit by the sun, where winds unfurled Sweep clouds to scatter pattering rain, And then blow back the sun again. I sell my fancies, or my swords, To those who care far more for words, Ideas, of which they are the sign, Than any other life-design. Who buy of me must simply pay Their whole existence quite away: Their strength, their manhood, and their prime, Their hours from morning till the time When evening comes on tiptoe feet, And losing life, think it complete; Must miss what other men count being, To gain the gift of deeper seeing; Must spurn all ease, all hindering love, All which could hold or bind; must prove The farthest boundaries of thought, And shun no end which these have brought; Then die in satisfaction, knowing That what was sown was worth the sowing. I claim for all the goods I sell That they will serve their purpose well, And though you perish, they will live. Full measure for your pay I give. To-day you worked, you thought, in vain. What since has happened is the train Your toiling brought. I spoke to you For my share of the bargain, due.' 'My life! And is that all you crave In pay? What even childhood gave! I have been dedicate from youth. Before my God I speak the truth!' Fatigue, excitement of the past Few hours broke me down at last. All day I had forgot to eat, My nerves betrayed me, lacking meat. I bowed my head and felt the storm Plough shattering through my prostrate form. The tearless sobs tore at my heart. My host withdrew himself apart; 234 Busied among his crockery, He paid no farther heed to me. Exhausted, spent, I huddled there, Within the arms of the old carved chair. A long half-hour dragged away, And then I heard a kind voice say, 'The day will soon be dawning, when You must begin to work again. Here are the things which you require.' By the fading light of the dying fire, And by the guttering candle's flare, I saw the old man standing there. He handed me a packet, tied With crimson tape, and sealed. 'Inside Are seeds of many differing flowers, To occupy your utmost powers Of storied vision, and these swords Are the finest which my shop affords. Go home and use them; do not spare Yourself; let that be all your care. Whatever you have means to buy Be very sure I can supply.' He slowly walked to the window, flung It open, and in the grey air rung The sound of distant matin bells. I took my parcels. Then, as tells An ancient mumbling monk his beads, I tried to thank for his courteous deeds My strange old friend. 'Nay, do not talk,' He urged me, 'you have a long walk Before you. Good-by and Good-day!' And gently sped upon my way I stumbled out in the morning hush, As down the empty street a flush Ran level from the rising sun. Another day was just begun. ~ Amy Lowell,

315:Cold Calls: War Music, Continued Many believe in the stars. Take Quinamid The son of a Dardanian astrologer Who disregarded what his father said And came to Troy in a taxi. Gone. Odysseus to Greece: “Hector has never fought this far from Troy. We want him further out. Beyond King Ilus’ tower. So walk him to the centre of the plain and, having killed him, Massacre the Trojans there.” “Ave!” Immediately beyond the ridge is Primrose Hill Where Paris favoured Aphrodité. “Take it,” said Hector. Greece shouted: “Hurry up!” Troy shouted: “Wait for us!” See, Far off, Masts behind the half-built palisade. Then Nearer to yourselves Scamánder’s ford From which the land ascends Then merges with the centre of the plain— The tower (a ruin) its highest point. Heaven. Bad music. Queen Hera is examining her gums. Looking in through a window Teenaged Athena says: “Trouble for Greece.” They leave. Sea. Sky. The sunlit snow. Two armies on the plain. Hector, driven by Lutie, His godchild and his nephew, Going from lord to Trojan lord: “The ships by dark.” The ruined tower. In front of it— Their banners rising one by one. One after one, and then another one— 50,000 Greeks. And on a rise in front of Greece Two hero lords: Ajax the Great of Salamis Behind his shield— As fifty Trojan shields Topped with blue plumes, swivelling their points, Come up the rise— Lord Teucer (five feet high and five feet wide) Loading his bow, Peering round Ajax’ shield, Dropping this Trojan plume or that, Ordering his archers to lie flat, Promising God as many sheep as there are sheep to count If he can put a shaft through Hector’s neck. Prosperity! Beneath the blue, between the sea, the snow, there Hector is Surrendering the urn of one he has just killed To one who thought that he had killed the same. Lord Teucer’s eye/Prince Hector’s throat. But God would not. The bowstring snaps. Outside God’s inner court. Queen Hera and Athena still in line. Hera so angry she can hardly speak. A voice: “The Wife, the Daughter.” “You go. His face will make me heave.” “Serene and Dignified Grandee.” “Papa to you.” “Papa”—His hand— “I know you do not want the Holy Family visiting the plain. But some of us would like to help the Greeks. They lost their champion she. Thousands of them have died. Now they are in retreat. Please look.” The plain. “You will come back the moment that I call?” “Of course, Papa.” “Then . . . yes. Encourage Greece. But voices only. Words. Shouts. That sort of thing. A move—and home you come.” “Of course, Papa.” The plain. Lord Teucer’s archers hidden in its grass. Chylábborak, Lord Hector’s brother-in-law, to his blue plumes: “Move!” “Move!” And on their flanks, between the sea and snow, Led by Teléspiax’ silver yard All Ilium’s masks “Down came their points. Out came their battle cry. And our cool Mr 5 x 5 called: ‘Up.’ And up we got And sent our arrows into them, That made them pirouette, Topple back down the rise, leaving their dead For some of us to strip, and some, the most, To pause, to point, to plant, a third, a fourth Volley into their naked backs. Pure joy!” Chylábborak, Holding his ground: “Centre on me. More die in broken than in standing ranks. Apollo! Aphrodité! Our gods are here! You taste the air, you taste their breath! The Greek fleet, ours, by dark!” Then he is ringed. See an imperial pig harassed by dogs. How, like a masterchef his crêpes, He tosses them; and on their way back down Eviscerates, then flips them back into the pack. Likewise Chylábborak the Greeks who rushed. Hector has seen it. As— Beneath the blue, the miles of empty air, Him just one glitter in that glittering mass— The hosts begin to merge. Fine dust clouds mixed with beams of light. The Prince, down from his plate. Either sides’ arrows whingeing by: “Cover my back.” Finding a gap Dismissing blows as gales do slates, Then at a run, leaping into the ring, Taking Chylábborak’s hand: “If you don’t mind?” Agamemnon: “Our time has come. God keeps his word. Fight now as you have never fought. We will be at Troy’s gates by dusk, Through them by dark, By dawn, across our oars, As we begin our journey home, Watching the windmills on its Wall Turn their sails in flames.” Heaven. The Wife. The Daughter. Hands release black lacquer clasps inlaid with particles of gold. Silk sheaths—with crashing waves and fishscales woven on a navy ground— Flow on the pavement. Hands take their hands While other hands supply Warwear, Their car, And put the reins into Athena’s hands. “. . . Troy’s gates by dusk, Through them by dark . . .” The Hours, the undeniable, Open the gates of Paradise. Beyond The wastes of space. Before The blue. Below Now near The sea, the snow. All time experts in hand-to-hand action— Friecourt, Okinawa, Stalingrad West— Could not believe the battle would gain. But it did. 10 Chylábborak’s ring is ringed. And then no ring at all. Some Trojans raise their hands in prayer; Some Panachéans shout for joy and wait to drag the corpses off. Lutie, alone, the reins in one, his other hand Hacking away the hands that grab his chariot’s bodywork, Rearing his horses, Starlight and Bertie, through, To, Yes, Chylábborak up; rescued; Prince Hector covering. Then: “Zoo-born wolf! Front for a family of thieves!” Lord Diomed, on foot, with Sethynos. My Lutie answering: “Be proud Prince Hector is your Fate.” (Which will be so, Though Lutie will not see it.) Chylábborak and Hector do not want to disappoint this oily pair: “Here come the Sisters Karamazof, Spark,” Chylábborak said. “Let’s send them home in halves.” And jumped back down. Around the tower, 1000 Greeks, 1000 Ilians, amid their swirl, His green hair dressed in braids, each braid Tipped with a little silver bell, note Nyro of Simi—the handsomest of all the Greeks, save A. The trouble was, he had no fight. He dashed from fight to fight, Struck a quick blow, then dashed straight out again. Save that this time he caught, As Prince Aenéas caught his breath, That Prince’s eye; who blocked his dash, And as Lord Panda waved and walked away, Took his head off his spine with a backhand slice— Beautiful stuff . . . straight from the blade . . . Still, as it was a special head, Mowgag, Aenéas’ minder— Bright as a box of rocks, but musical— 11 Spiked it, then hoisted it, and twizzling the pole Beneath the blue, the miles of empty air, Marched to the chingaling of its tinklers, A knees high majorette Towards the Greeks, the tower. A roar of wind across the battlefield. A pause. And then Scattering light, The plain turned crystal where their glidepath stopped, The Queen of Heaven shrills: “Typhoid for Troy!” And through poor Nyro’s wobbling mouth Athena yells: “Slew of assiduous mediocrities! Meek Greeks!” It is enough. Centre-plain wide, Lit everywhere by rays of glorious light, They rushed their standards into Ilium, Diomed (for once) swept forward; Converting shame to exaltation with his cry: “Never—to Helen’s gold without her self! Never—to Helen’s self without her gold!” Mowgag well slain. Hewn through his teeth, his jaw slashed off, And Nyro’s head beside him in the grass. When Nyro’s mother heard of this 12 She shaved her head; she tore her frock; she went outside Ripping her fingernails through her cheeks: Then down her neck; her chest; her breasts; And bleeding to her waist ran round the shops, Sobbing: “God, kill Troy. Console me with its death. Revenge is all I have. My boy was kind. He had his life to live. I will not have the chance to dance in Hector’s blood, But let me hear some have before I die.” “I saw her running round. I took the photograph. It summed the situation up. He was her son. They put it out in colour. Right? My picture went around the world.” Down the shaft of the shot in his short-staved bow Lord Panda has been follow-spotting Diomed. Between “her self ” / “her gold” he shoots. It hits. And as its barbs protrude through Dio’s back Aenéas hears Lord Panda shout: “He bleeds! The totem Greek! Right-shoulder-front! How wise of Artemis to make Panda her matador! Her numero uno! Moi!” Diomed hit, The heart went out of those who followed him And they fell back. Shields all round Diomed on his knees 13 Lifting his hands: “Sister and wife of God” As Sethynos breaks off the arrowhead “Eliminate my pain.” Settles his knee beneath his hero’s shoulderblades “Let me kill that oaf who claims my death” Bridges his nape with one hand “Before it comes with honour to my name.” Then with his other hand In one long strong slow pull Drew the shank back, and out. She heard his prayer. Before their breathless eyes His blood ran back into the pout the shank had left, And to complete her miracle Lord Diomed rose up between them, stood in the air, Then hovered down onto his toes Brimming with homicidal joy, Imparting it to Greece. Then Troy was driven back, Trampling the half-stripped still-masked carcasses Hatching the centre of the plain. Aenéas / Panda. “Get him.” 14 “Get him! I got him. He is dead. But there he is.” And Diomed has spotted them. “Calm down,” Aenéas said. “Perhaps he is possessed.” “What god would visit him?” “So pray to yours—and try another shot.” “Huntress,” Lord Panda prays, Bright-ankled god of nets and lines, Of tangled mountains, ilex groves and dark cascades . . .” But Artemis was bored with him And let him rise, still praying hard, Into the downflight of the javelin Diomed aired at Prince Aenéas. Sunlit, it went through Panda’s lips, out through his neck, and then Through Biblock’s neck. And so they fell; the lord, face up; the friend, face down Gripping the blood-smeared barb between his teeth, Between the sea and snow. Aenéas covers them. Eyeing his plate —Technology you can enjoy— Diomed found, and threw, a stone As heavy as a cabbage made of lead, That hit, and split, Aenéas’ hip. Who went down on one knee And put his shield hand on the grass And with his other hand covered his eyes. Dido might have become a grandmother And Rome not had its day, except As Diomed came on to lop his top Aenéas’ mama, Aphrodité (dressed In grey silk lounge pyjamas piped with gold And snake-skin flip-flops) stepped 15 Between him and the Greek. A glow came from her throat, and from her hair A fragrance that betokened the divine. Stooping, she kissed him better, as Queen Hera whispered: “Greek, cut that bitch.” And, Diomed, you did; nicking Love’s wrist. Studying the ichor as It seeped across her pulse into her palm Our Lady of the Thong lifted her other hand Removed a baby cobra from her hair And dropped it, Diomed, onto your neck, And saw its bite release its bane into your blood. Then nobody could say Who Diomed fought for, or for what he fought. Rapt through the mass Now shouting at the sky, now stomping on the plain, He killed and killed and killed, Greek, Trojan, Greek, Lord/less, shame/fame, both gone; and gone Loyalty nurtured in the face of death, The duty of revenge, the right to kill, To jeer, to strip, to gloat, to be the first To rally but the last to run, all gone— And gone, our Lady Aphrodité, giggling. While everywhere, Driving your fellow Greeks Back down the long incline that leads to the Scamánder’s ford, Surely as when Lit from the dark part of the sky by sudden beams, A bitter wind Detonates line by line of waves against the shore. No mind. Even as Teucer backed away He kept his eyes on you. “You feel the stress? You feel the fear? Behold your enemy! the Prince God loves!” See Teucer’s bow. Hear Teucer’s: “This time lucky.” 16 His— But this time it was not our Father, God, Who saved your life, my Prince. As Agamemnon cried: “The ships are safe. Stand at the riverside’s far bank.” Teléspiax heard the rustle of Lord Teucer’s shot And stood between yourself and it. His head was opened, egglike, at the back, Mucked with thick blood, blood trickling from his mouth. His last words were: “Prince, your trumpeter has lost his breath.” “Our worst fear was his face would fade,” Teléspiax’s father said. “But it did not. We will remember it until we die.” “Give his instrument to Hogem,” Hector said, and went— Lutie on reins—between the sea and snow, Throwing his chariots wide, Scamánderwards, As easily as others might a cloak. Diomed among this traffic, on his own, Among his dead, Their pools of blood, their cut-off body-parts, Their cut-off heads, Ashamed as his head cleared To see Odysseus, Idomeneo, the Ajax—Big and Small— Whipping away downslope, shouting towards Odysseus: “Where are you going with your back to the battle?” Who shouted back, although he did not turn: “Look left!” And there was Lutie driving Hector onto him, Sure they would trample him, for sure Queen Hera’s human, Diomed, Would stand and die, except: “Arms up, young king—” Nestor, full tilt, Reins round his tummy, leaning out “—and 17 Jump . . .” wrists locked “. . . You young are just . . .” Swinging him up onto the plate “. . . too much.” “With your permission, Da?” Nod. Drew. Then threw the chariot’s javelin As Lutie spun his wheels, and Hector threw— Those skewers trading brilliance as they passed— And missed—both vehicles slither-straightening, Regaining speed, close, close, then driven apart By empty cars careering off the incline, Or stationary cars, their horses cropping grass. “Daddy, go slow. Hector will say I ran.” “But not the widows you have made.” And slow And low Cruising the blue above this mix Heaven’s Queen and Ringsight-eyed Athena Trumpeting down huge worms of sound As Hector’s car rereached king Nestor’s, and: “What kept you, Prince?” Diomed offered as they came abreast: “You went for a refreshing towel?” And threw his axe, that toppled through the air, and, oh, Hector, my Hector, as you thought: “If Heaven helps me Heaven shows it loves the best,” Parted your Lutie’s mesh and smashed into his heart. What did you say as God called you to death Dear Lutie? “King Prince, I leave you driverless.” And put the reins into his hands, and fled Into oblivion As Hector with his other hand Held what his Lutie was, upright, face forwards, in between The chariot’s basket and himself, Shouting as he drove after them: “Loathsome Greek, 18 Your loathsome hair, your loathsome blood, Your loathsome breath, your loathsome heart, Jump in your loathsome ships, I will come after you, Come over the Aegean after you, And find you though you hide inside Your loathsome father’s grave And with my bare hands twist your loathsome head Off your loathsome neck.” There was a Greek called Themion. Mad about armour. If not armour, cars. Of course he went to Troy. And Troy Saw a stray spear transfix him as he drove. Companionably, his horses galloped up On Starlight’s side, and muddled Starlight down, And Bertie down, and brought the Prince (Still holding Lutie) down, as all the world Hurried, as if by windheads, on towards Scamánder’s ford. hether you reach it from the palisade Or through the trees that dot the incline’s last stretch You hear Scamánder’s voice before you see What one may talk across on quiet days Its rippling sunspangled breadth Streaming across the bars of pebbly sand That form its ford —Though on the Fleet’s side deeper, darkly bright. And here Tiptoeing from this bar to that, Settling the cloudy sunshine of her hair, Her towel retained by nothing save herself, The god of Tops and Thongs Our Lady Aphrodité came, Her eyes brimfull with tears. Scamánder is astonished by his luck. 19 “Beauty of Beauties, why are you weeping?” “I have been hurt, Scamánder.” “No . . .” “Humiliated.” “No . . .” “Me. A god. Just like yourself. Touched . . .” “Touched!” “By a man.” “A man!” “A Greek.” “Death to all Greeks!” “He cut me!” “Sacrilege! . . . But where?” “I need your healing touch.” “How can I help you if you do not show me where?” “Moisten its lips and my wound will be healed.” “You must say where!” “Well . . .” The towel has slipped an inch. “I am afraid you will be disappointed.” “Never.” “Are you sure?” “Yes!” “You will not criticize me?” “No!” Her wrist upturned. Out-turned. Her opened palm. Fanning the fingers of her other hand, Stroking his spangles with her fingertips. “Goddess, I love you. I have always loved you. Say that you love me. Even a little. I beg you. God grant it.” “I need your help, Scamánder.” “Take pity on me. Come into me.” “You have your nymphs.” “Bores! Bores!” “I might be nibbled by an eel!” “Death to all eels!” The towel is down. 20 “Step into me . . . I love your toes . . . please let me kiss your toes . . . Your little dinkum-inkum toes . . .” “No one has kissed them so nicely, Scamánder.” “And now your knees . . .” “You tickle me . . .” “And now your thighs!” “Oh, oh, go on . . .” “And now your bum! Your Holy Bum! Your Sacred Bum! The Bum of Paradise!” “Oh, my Scamánder, I must have your help . . .” “Anything!” The towel goes curling off, And as she floated on his stream Our Lady Aphrodité said: “At any moment now the Greeks will reach your Troy-side bank . . .” Recall those sequences When horsemen ride out of the trees and down into a Somewhere in Kansas or Missouri, say. So—save they were thousands—Greece Into Scamánder’s ford. stream Coming downstream, A smallish wave That passes But Scamánder’s flow does not relapse. Indeed Almost without a sound Its murmuring radiance rose Into a dark, torrential surge, Clouded with boulders, crammed with trees, as clamorous 21 as if it were a sea, That lifted Greece, then pulled Greece down, Cars gone, masks gone, gone under, reappearing, gone: “Onto your knees! Praise Hector for this flood! The Prince God loves!” Prince Hector claims As he comes through the trees. They do. Then up and run, run, thousands of them, To hold those Greeks who got back out Under until their bubbles stopped; while those swept off Turned somersaults amid Scamánder’s undertow. The flat— 1000 yards of it between the river and the palisade. The King: “The Lord has not abandoned us. To cross will be as bad for them.” But it was not to be as bad for them. Indeed, As Hector drove towards Scamánder’s brink, And as—their banners rising one by one, One after one and then another one— He and all Ilium began to enter it, The river reassumed its softly-spoken, smooth, sunspangled way. And Agamemnon cried: “God, what are You for? What use are You to me?” As Hector cries: 22 “Two miracles! Your Prince is close to God!” And Hera to Athena: “Fog?” And fog came down. And most of Greece got out. Troy holding hands midstream. An army peering through its masks. Miss Tops and Thongs to God: “Your Hera has . . .” And with a wish He turned the fog to light And with a word He called them back to Heaven. Sky. Snow. The 1000 yards. The palisade. Hector: “I am your Prince. My name means He-Who-Holds. Troy. And the plain. And now the ships. For Troy!” his battle cry, Rising into a common cry, that cry Into a clamour, and that clamour to Bayings of hatred. 23 800 yards. The Child: “We are the Greeks. We fight to win. If one is lost, Close his eyes, step over him, and kill his enemy.” 800 yards. The Greeks are tiring. Nestor is on his knees: “God of all Gods, Most Holy and Most High, If Greece has ever sacrificed fresh blood to you, Protect our ships.” Heaven. Soft music. Summertime. Queen Hera and Athena? Yes . . . Some lesser gods Observing their approach, approach, Salaam, and then Lead them— Now both in black wraparound tops— To God: “Darling Daddy, here we are.” “And” (Hera) “here we stay Until you stop that worthless Hector killing Greeks.” Up steps Love. Hera: “Why is she wearing a tent?” Love: “Father, see this.” (Her wrist.) “Human strikes god! Communism! The end of everything!” “Darlings,” He said, “You know that being a god means being blamed. Do this—no good. Do that—the same. The answer is: Avoid humanity. Remember—I am God. I see the bigger picture.” 24 “And I am Hera, Heaven’s Queen, Greece worships me.” “Stuff Greece,” Love said. “Your blubber-bummed wife with her gobstopper nipples Hates Troy because Troy’s Paris put her last When we stripped off for him. As for the Ithacan boat-boy’s undercurved preceptatrix, She hates Troy because my statue stands on its acropolis.” Hera: “The cities’ whores were taxed to pay for it.” Love (Dropping onto her knees before Himself): “Please . . . stop them harming Troy. The greatest city in the world.” While Hera and Athena sang: “Cleavage! Cleavage! Queen of the Foaming Hole. Mammoth or man or midge She sucks from pole to pole.” And God has had enough of it. Lifting His scales He said: “Hector will have his day of victory.” Then crashed them to the ground. 700 yards. The palisade. Its gate. Late sunlight on gilt beaks. “There’s no escape from Troy.” “Or from the plain at Troy.” 25 Begging for ransom, Trojan Hoti, His arms around King Menelaos’ knees. King Agamemnon: “Off.” Then he punched Hoti in the face. Then punched him in the face again. And then again. And when he fell King Agamemnon kicked him in the groin. Kicking him in the groin with so much force It took a step to follow up each kick. Then pulled him up, Then dragged him by his hair This way and that, Then left him, calling: “Finish him off.” And someone did. “I was sixteen. I said: ‘Where is Achilles?’ Hard as it is to share another’s troubles when your own are pressing Great Ajax took my hands in his and said: ‘He loves us. He is with us. He will come.’” But he did not. Then Ajax to himself: “Dear Lord, you made me straight. Give me the strength to last till dark.” The Prince: “I get past Their war is lost.” everything I see. It was. Aenéas, Ábassee, Sarpédon, Gray, Calling to one another down the line. Then, with a mighty wall of sound, As if a slope of stones Rolled down into a lake of broken glass 26 We ran at them. And now the light of evening has begun To shawl across the plain: Blue gray, gold gray, blue gold, Translucent nothingnesses Readying our space, Within the deep, unchanging sea of space, For Hesper’s entrance, and the silver wrap. Covered with blood, mostly their own, Loyal to death, reckoning to die Odysseus, Ajax, Diomed, Idomeneo, Nestor, Menelaos And the King: “Do not die because others have died.” “Do not show them the palms of your hands.” “Achil!” “Achil!” “If he won’t help us, Heaven help us.” “Stand still and fight.” “Feel shame in one another’s eyes.” “I curse you, God. You are a liar, God. Troy will be yours by dark—immortal lies.” “Home!” “Home!” “There’s no such place.” “You can’t launch burning ships.” “More men survive if no one runs.” But that is what Greece did. Dropping their wounded, Throwing down their dead, Their shields, their spears, their swords, They ran. 27 Leaving their heroes tattered, filthy, torn And ran And ran Above their cries: “I am the Prince! The victory is mine!” Chylábborak: “Do not take cowardice for granted.” Scarce had he said it, when His son, Kykéon, standing next to him Took Ajax’ final spear cast in his chest. “I shall not wear your armour, Sir,” he said. And died. “My son is dead.” The Prince: “Hector is loved by God.” And Greece, a wall of walking swords, But walking backwards, Leaving the plain in silence And in tears. Idomeneo, Running back out at those Trojans who came too close: “You know my name. Come look for me. And boy, The day you do will be the day you die.” 28 Hector to Troy: “Soldiers!— Unmatched my force, unconquerable my will. After ten years of days, in one long day To be remembered for as many days As there are days to come, this is my day, Your Hector’s day. Troy given back to Troy. My day of victory!” And when the cheering died: “Some say: destroy Greece now. But I say no. Out of your cars. Eat by your fires. Two hundred fires! Around each fire Five hundred men! “The sound of grindstones turning through the night, The firelight that stands between our blades, So let King Agamemnon’s Own hold hands And look into each other’s frightened eyes. “True God! Great Master of the Widespread Sky! If only you would turn Me into a god, As you, through me, Tomorrow by their ships Will see Greece die.” Silence. A ring of lights. Within Immaculate In boat-cloaks lined with red King Agamemnon’s lords— The depression of retreat. 29 The depression of returning to camp. Him at the centre of their circle Sobbing, Then shouting: “We must run for it!” Dark glasses in parked cars. “King Agamemnon of Mycenae, God called, God raised, God recognized, You are a piece of shit,” Diomed said. Silence again. “Let us praise God,” Lord Ajax said, “That Hector stopped before he reached the ships.” Silence again. Then Nestor (Putting his knee back in): “Paramount Agamemnon, King of Kings, Lord of the Shore, the Islands and the Sea I shall begin, and end, with you. Greece needs good words. Like them or not, the credit will be yours. Determined. Keen to fight, that is our Diomed— As I should know. When just a boy of ten I fought Blowback of Missolonghi, a cannibal, drank blood, He captured you, he buggered you, you never walked again. But Diomed lacks experience. God has saved us, momentarily. God loves Achilles. You took, and you have kept, Achilles’ ribband she.” “I was a fool!” 30 “And now you must appease him, Agamemnon. Humble words. Hands shaken. Gifts.” The King—wiping his eyes: “As usual, Pylos has said the only things worth hearing. I was mad to take the she. I shall pay fitting damages. Plus her, I offer him The Corfiot armour that my father wore.” Silence. The sea. Its whispering. “To which I add: a set of shields. Posy, standard, ceremonial. The last, cut from the hide of a one ton Lesbian bull.” Silence. The sea. “And . . . a chariot! From my own équipe! They smoke along the ground . . . They ride its undulations like a breeze . . .” The sea. “Plus: six horses—saddled, bridled and caparisoned, Their grooms and veterinarians . . . . . . And six tall shes: Two good dancers, two good stitchers, two good cooks. All capable of bearing boys . . . “Oh, very well then: twenty loaves of gold, 31 The same of silver, and the same of iron.” Masks. Lights. Behind the lords Some hundreds from the army have walked up. Lord Nestor smiles. Lord Menelaos smiles. “Plus— Though it may well reduce your King to destitution: A’kimi’kúriex, My summer palace by the Argive sea, Its lawns, its terraces, its curtains in whose depths Larks dive above a field of waving lilies And fishscale-breakers shatter on blue rocks. Then, as he draws their silky heights aside, Standing among huge chests of looted booty, Long necked, with lowered lids, but candid eyes, My living daughter, Íphaniss, a diamond Big as a cheeseball for her belly stud. His wife to be! minus—I need not say—her otherwise huge bride-price.” “More!” “More!” “More!” Lord Ajax almost has to hold him up. “The whole of eastern Pel’po’nesia— An area of outstanding natural beauty— Its cities, Epi’dávros, Trów’é’zen, Their fortresses, their harbours and their fleets, Their taxpayers—glad to accept his modest ways— All this, the greatest benefaction ever known, If he agrees to fight. And he admits I am his King.” Instantly, Nestor: “An offer God himself could not refuse. All that remains to say is: Who shall take it to Achilles?” 32 Agamemnon: “You will.” Starlight. The starlight on the sea. The sea. Its whispering Mixed with the prayers Of Ajax and of Nestor as they walk Along the shore towards Achilles’ gate. “My lords?” “Your lord.” “This way.” They find him, with guitar, Singing of Gilgamesh. “Take my hands. Here they are.” You cannot take your eyes away from him. His own so bright they slow you down. His voice so low, and yet so clear. You know that he is dangerous. “Patroclus? 33 Friends in need. Still, Friends. That has not changed, I think. Autómedon? Wine. “Dear Lord and Master of the Widespread Sky, Accept ourselves, accept our prayers.” Their cups are taken. “Father friend?” King Nestor (for his life): “You know why we are here. We face death. The mass choose slavery. Mycenae has admitted he was wrong to wrong yourself. In recompense he offers you The greatest benefaction ever known. Take it, and fight. Or else Hector will burn the ships Then kill us randomly. Remember what your Father said The day when Ajax and myself drove up to ask If you could come with us to Troy? That you should stand among the blades where honour grows. And secondly, to let your anger go. Spirit, and strength, and beauty have combined Such awesome power in you A vacant Heaven would offer you its throne. Think of what those who will come after us will say. Save us from Hector’s god, from Hector, and from Hector’s force. I go down on my knees to you, Achilles.” “I must admire your courage, father friend, For treating me as if I was a fool. 34 I shall deal with Hector as I want to. You and your fellow countrymen will die For how your King has treated me. I have spent five years fighting for your King. My record is: ten coastal and ten inland cities Burnt to the ground. Their males, massacred. Their cattle, and their women, given to him. Among the rest, Briseis the Beautiful, my ribband she. Not that I got her courtesy of him. She joined my stock in recognition of My strength, my courage, my superiority, Courtesy of yourselves, my lords. I will not fight for him. He aims to personalise my loss. Briseis taken from Achilles—standard practice: Helen from Menelaos—war. Lord Busy Busy, building his palisade, mounting my she, One that I might have picked to run my house, Raising her to the status of a wife. Do I hate him? Yes, I hate him. Hate him. And should he be afraid of me? He should. I want to harm him. I want him to feel pain. In his body, and between his ears. I must admit, Some of the things that you have said are true. But look what he has done to me! To me! The king on whom his kingliness depends! I will not fight for him. Hearing your steps, I thought: at last, My friends have come to visit me. They took their time about it, true— After he took my she none of you came— Now, though—admittedly they are in trouble, Serious trouble—they have arrived as friends, And of their own accord. But you have not come here as friends. And you have not come of your own accord. You came because your King told you to come. You came because I am his last resort. And, incidentally, your last resort. 35 At least he offers stuff. All you have offered is advice: ‘Keep your temper . . . Mind your tongue . . . Think what the world will say . . .’ No mention of your King’s treatment of me. No sign of love for me behind your tears. I will not fight for him. I can remember very well indeed The day you two grand lords came visiting my father’s house, How I ran out to you, and took your hands— The greatest men that I had ever seen: Ajax, my fighting cousin, strong, brave, unafraid to die; Nestor, the King of Sandy Pylos, wisdom’s sword. And then, when all had had enough to eat and drink And it was sealed that I should come to Troy, Then my dear father said that lordship knows Not only how to fight, and when to hold its tongue, But of the difference between a child enraged And honour bound lords. I will not fight for him. There is a King to be maintained. You are his lords. My fighting powers prove my inferiority. Whatever he, through you, may grant, I must receive it as a favour, not of right, Go back to him with downcast looks, a suppliant tone, Acknowledge my transgressions—I did not Applaud his sticky fingers on my she’s meek flesh. My mother says I have a choice: Live as a happy backwood king for aye Or give the world an everlasting murmur of my name, And die. Be up tomorrow sharp To see me sacrifice to Lord Poseidon and set sail. Oh, yes, his gifts: ‘The greatest benefaction ever known.’ If he put Heaven in my hand I would not want it. His offers magnify himself. Likewise his child. I do not want to trash the girl. She is like me. Bad luck to have poor friends. Bad luck to have his Kingship as your sire. 36 My father will select my wife. Each spring a dozen local kings drive up And lead their daughters naked round our yard. Some decent local girl. My father’s worth Is all the wealth we will require. You Greeks will not take Troy. You have disintegrated as a fighting force. Troy is your cemetery. Blame your King. The man who you say has done all he can. The man who has admitted he was wrong. But he has not done all he can. And he has not admitted he was wrong. Or not to me. I want him here, your King. His arms straight down his sides, his shoulders back, Announcing loud and clear that he was wrong to take my she. Apologising for that wrong, to me, the son of Péleus. Before my followers, with you, Pylos and Salamis, Crete. Sparta. Tyrins, Argos, Calydon, the Islands, here, Stood to attention on either side of him. That is my offer. Take it, or die. Nestor may stay the night. You, dear cousin Ajax, tell your King what I have said. Preferably, in front of everyone.” Who said, As my Achilles lifted his guitar: “Lord, I was never so bethumped with words Since first I called my father Dad.” The sea. Their feet along the sand to Agamemnon’s gate. And in starlit air The Trojans singing: “I love my wife, I love her dearly, I love the hole she pisses through, 37 I love her lily-white tits And her nut-brown arsehole, I could eat her shit with a wooden spoon.” ~ Christopher Logue,

   3 Fiction
   2 Integral Yoga
   1 Occultism


   3 H P Lovecraft
   2 The Mother
   2 Satprem


   3 Lovecraft - Poems
   2 Agenda Vol 13

0 1972-04-26, #Agenda Vol 13, #The Mother, #Integral Yoga    Strange. I liked the book very much when I read it, but the only image that remains now is a primeval forest with a huge tree and you struggling to blaze your way through the tree thats what I see all the time (Mother looks again). Why? Thats it, thats what stayed in the consciousness. I can still see you with an axe, Hacking off huge branches to open up a passage. Strange. Is it symbolic? Do you mention that scene in your book?    Not exactly, but I lived something like that9its both true and symbolic at the same time.   --    That struck me very much. That and the huge tree. But the tree is larger than life, its symbolic; and with a big axe you are Hacking off brancheshuge branches, as big as treesto open up a passage.    Strange.    Well, I guess Im still Hacking away at branches!    (Mother laughs) Yes, exactly! Thats right.

0 1972-12-06, #Agenda Vol 13, #The Mother, #Integral Yoga    (One can hear the axes Hacking away at the broken branches of the great yellow flame tree called Service, which spreads its foliage above Sri Aurobindos tomb.)    The tree that gave me all my Transformation flowers [from Satprems garden] is broken. The Service tree also: some of its branches have been torn off.

1.01 - Economy, #Walden, and On The Duty Of Civil Disobedience, #Henry David Thoreau, #Philosophy   I offered him, he had so many _intra_ ones. This ducking was the very thing he needed. Then I began to pity myself, and I saw that it would be a greater charity to bestow on me a flannel shirt than a whole slop-shop on him. There are a thousand Hacking at the branches of evil to one who is striking at the root, and it may be that he who bestows the largest amount of time and money on the needy is doing the most by his mode of life to produce that misery which he strives in vain to relieve. It is the pious slave-breeder devoting the proceeds of every tenth slave to buy a Sundays liberty for the rest. Some show their kindness to the poor by employing them in their kitchens. Would they not be kinder if they employed themselves there? You boast of spending a tenth part of your income in charity; maybe you should spend the nine tenths so, and done with it. Society recovers only a tenth part of the property then. Is this owing to the generosity of him in whose possession it is found, or to the remissness of the officers of justice?   Philanthropy is almost the only virtue which is sufficiently appreciated by mankind. Nay, it is greatly overrated; and it is our selfishness which overrates it. A robust poor man, one sunny day here in Concord, praised a fellow-townsman to me, because, as he said, he was kind to the poor; meaning himself. The kind uncles and aunts of the race are more esteemed than its true spiritual fathers and mothers. I once heard a reverend lecturer on England, a man of learning and intelligence, after enumerating her scientific, literary, and political worthies, Shakespeare, Bacon, Cromwell, Milton, Newton, and others, speak next of her Christian heroes, whom, as if his profession required it of him, he elevated to a place far above all the rest, as the greatest of the great. They were Penn, Howard, and Mrs. Fry. Every one must feel the falsehood and cant of this. The last were not Englands best men and women; only, perhaps, her best philanthropists.

1.18 - The Perils of the Soul, #The Golden Bough, #James George Frazer, #Occultism   pike or Hacking it with a sword. After Sankara had destroyed the   Buddhists in India, it is said that he journeyed to Nepaul, where he

1f.lovecraft - At the Mountains of Madness, #Lovecraft - Poems, #unset, #Zen    penetrant bores, and apparently Hacking incisions. One or two cases    of cleanly severed bone. Not many specimens affected. Am sending to   --    Hacking away stalactites.    Still later. Have found peculiar soapstone fragment about six

1f.lovecraft - The Mound, #Lovecraft - Poems, #unset, #Zen    mystery, and watchers from the village saw him Hacking diligently at    the shrubbery atop the mound. Then they saw his figure melt slowly into   --    he was Hacking at the shrubbery with a brush-cutter. No one could say    more than that he was there one moment and absent the next. For over a   --    Hacking at the mould-caked root-tangle with my machete, I felt that    they were against me againbut at no time were they strong enough to

1f.lovecraft - The Whisperer in Darkness, #Lovecraft - Poems, #unset, #Zen    little, but then a kind of apologetic Hacking or whispering sound drew    my attention to a great easy-chair in the farther, darker corner of the   --    And then I saw that he was trying to talk in the same Hacking whisper    with which he had greeted me. It was a hard whisper to catch at first,

2.24 - The Evolution of the Spiritual Man, #The Life Divine, #Sri Aurobindo, #Integral Yoga   A complete denial of religion, occultism and all that is supraphysical is the last outcome of this stage, a hard dry paroxysm of the superficial intellect Hacking away the sheltering structures that are refuges for the deeper parts of our nature. But still evolutionary Nature keeps alive her ulterior intentions in the minds of a few and uses man's greater mental evolution to raise them to a higher plane and deeper issues. In the present time itself, after an age of triumphant intellectuality and materialism, we can see evidences of this natural process, - a return towards inner self-discovery, an inner seeking and thinking, a new attempt at mystic experience, a groping after the inner self, a reawakening to some sense of the truth and power of the spirit begins to manifest itself; man's search after his self and soul and a deeper truth of things tends to revive and resume its lost force and to give a fresh life to the old creeds, erect new faiths or develop independently of sectarian religions. The intellect itself, having reached near to the natural limits of the capacity of physical discovery, having touched its bedrock and found that it explains nothing more than the outer process of Nature, has begun, still tentatively and hesitatingly, to direct an eye of research on the deeper secrets of the mind and the life force and on the domain of the occult which it had rejected a priori, in order to know what there may be in it that is true. Religion itself has shown its power of survival and is undergoing an evolution the final sense of which is still obscure. In this new phase of the mind that we see beginning, however crudely and hesitatingly, there can be detected the possibility of a pressure towards some decisive turn and advance of the spiritual evolution in Nature. Religion, rich but with a certain obscurity in her first infrarational stage, had tended under the overweight of the intellect to pass into a clear but bare rational interspace; but it must in the end follow the upward curve of the human mind and rise more fully at its summits towards its true or greatest field in the sphere of a suprarational consciousness and knowledge.   If we look at the past, we can still see the evidences of this line of natural evolution, although most of its earlier stages are hidden from us in the unwritten pages of prehistory. It has been contended that religion in its beginnings was nothing but a mass of animism, fetishism, magic, totemism, taboo, myth, superstitious symbol, with the medicine-man as priest, a mental fungus of primitive human ignorance, - later on at its best a form of Nature-worship. It could well have been so in the primitive mind, though we have to add the proviso that behind much of its beliefs and practices there may have been a truth of an inferior but very effective kind that we have lost with our superior development. Primitive man lives much in a low and small province of his life-being, and this corresponds on the occult plane to an invisible Nature which is of a like character and whose occult powers can be called into activity by a knowledge and methods to which the lower vital intuitions and instincts may open a door of access. This might be formulated in a first stage of religious belief and practice which would be occult after a crude inchoate fashion in its character and interests, not yet spiritual; its main element would be a calling in of small lifepowers and elemental beings to the aid of small life-desires and a rude physical welfare.

Aeneid, #unset, #Arthur C Clarke, #Fiction   Some hurry to the gateways, Hacking down   the first guards they encounter; others cast

The Pilgrims Progress, #unset, #Arthur C Clarke, #Fiction   {83} Then the Interpreter took him, and led him up towards the door of the palace; and behold, at the door stood a great company of men, as desirous to go in; but durst not. There also sat a man at a little distance from the door, at a table-side, with a book and his inkhorn before him, to take the name of him that should enter therein; he saw also, that in the doorway stood many men in armour to keep it, being resolved to do the men that would enter what hurt and mischief they could. Now was Christian somewhat in amaze. At last, when every man started back for fear of the armed men, Christian saw a man of a very stout countenance come up to the man that sat there to write, saying, Set down my name, Sir: the which when he had done, he saw the man draw his sword, and put a helmet upon his head, and rush toward the door upon the armed men, who laid upon him with deadly force; but the man, not at all discouraged, fell to cutting and Hacking most fiercely. So after he had received and given many wounds to those that attempted to keep him out, he cut his way through them all [Acts 14:22], and pressed forward into the palace, at which there was a pleasant voice heard from those that were within, even of those that walked upon the top of the palace, saying--   "Come in, come in; Eternal glory thou shalt win."

Wikipedia - Advanced persistent threat -- Set of stealthy and continuous computer hacking processes

Wikipedia - Automotive hacking -- The exploitation of vulnerabilities within the software, hardware, and communication systems of automobiles

Wikipedia - Billboard hacking

Wikipedia - Black hat hacking

Wikipedia - Category:Films about computer hacking

Wikipedia - Category:Hacking (computer security)

Wikipedia - Category:Hacking in the 1980s

Wikipedia - Cheat Engine -- Memory hacking software

Wikipedia - Computer hacking

Wikipedia - Email hacking -- Unauthorized access to, or manipulation of, an email account or email correspondence

Wikipedia - Ethical hacking

Wikipedia - GnosticPlayers -- Computer hacking group

Wikipedia - Government hacking -- Computer hacking perpetrated by governments

Wikipedia - Grinder (biohacking community)

Wikipedia - Grinder (biohacking)

Wikipedia - Hackaday -- A hardware hacking website

Wikipedia - Hacking Democracy -- 2006 film by Simon Ardizzone

Wikipedia - Hacking (innovation)

Wikipedia - Hacking Matter -- Book by Wil McCarthy

Wikipedia - Hacking of consumer electronics

Wikipedia - Hacking tool

Wikipedia - HackTool.Win32.HackAV -- DDfinition from Kaspersky Labs for a program designed to assist hacking

Wikipedia - Happy Hacking Keyboard

Wikipedia - Ian Hacking

Wikipedia - Lauri Love -- British activist previously wanted by the United States on hacking charges

Wikipedia - Legion of Doom (hacking) -- Hacker group

Wikipedia - Level Seven (hacking group) -- Hacker group

Wikipedia - List of news media phone hacking scandal victims -- Wikipedia list article

Wikipedia - List of people arrested in the News International phone-hacking scandal -- Wikipedia list article

Wikipedia - List of security hacking incidents -- Wikipedia list article

Wikipedia - Neurohacking

Wikipedia - News International phone hacking scandal -- Media scandal

Wikipedia - Offensive Security Certified Professional -- Ethical hacking certification by Offensive Security

Wikipedia - Pass the hash -- Hacking technique

Wikipedia - Phile -- files about hacking

Wikipedia - Port Hacking -- Estuary in southern Sydney, Australia

Wikipedia - Pwn2Own -- Computer hacking contest

Wikipedia - Reality Hacking

Wikipedia - Rewriting the Soul -- 1995 book by Ian Hacking

Wikipedia - ROM hacking -- Video game editing technique

Wikipedia - Roof and tunnel hacking

Wikipedia - Template talk:Computer hacking

Wikipedia - Template talk:Hacking in the 1980s

Wikipedia - The Secret History of Hacking -- 2001 film by Ralph Lee

Wikipedia - The Taming of Chance -- 1990 book by Ian Hacking

Wikipedia - Wallhacking

Wikipedia - Wikipedia:Whacking with a wet trout -- Humorous Wikipedia project page

Ian Hacking ::: Born: February 18, 1936; Occupation: Philosopher;

https://www.goodreads.com/book/show/10754454-language-hacking-guide

https://www.goodreads.com/book/show/1342300.Hacking_del_Icio_Us

https://www.goodreads.com/book/show/17876446-hacking-politics

https://www.goodreads.com/book/show/18164.Hardware_Hacking

https://www.goodreads.com/book/show/18710039-the-ultimate-guide-to-travel-hacking

https://www.goodreads.com/book/show/1993945.Hacking_Harvard

https://www.goodreads.com/book/show/20347614-the-phone-hacking-affair

https://www.goodreads.com/book/show/20936133-growth-hacking-with-content-marketing

https://www.goodreads.com/book/show/22966671-hacking-human-nature-for-good

https://www.goodreads.com/book/show/23857762-profit-hacking

https://www.goodreads.com/book/show/23972780-mind-hacking

https://www.goodreads.com/book/show/25111013-mind-hacking

https://www.goodreads.com/book/show/25679709-life-hacking

https://www.goodreads.com/book/show/26829118-hacking

https://www.goodreads.com/book/show/26854189-il-rumore-dell-hacking

https://www.goodreads.com/book/show/26877420-the-small-business-guide-to-growth-hacking

https://www.goodreads.com/book/show/28281527-slipstream-time-hacking

https://www.goodreads.com/book/show/28364817-the-dark-side-of-the-hacking-world

https://www.goodreads.com/book/show/28450909-language-hacking-french

https://www.goodreads.com/book/show/28450910-language-hacking-italian

https://www.goodreads.com/book/show/28450911-language-hacking-german-learn-how-to-speak-german---right-away

https://www.goodreads.com/book/show/28450912-language-hacking-spanish

https://www.goodreads.com/book/show/29778972-hacking-chinese

https://www.goodreads.com/book/show/31213211-hacking-isis

https://www.goodreads.com/book/show/33838194-shacking-up

https://www.goodreads.com/book/show/34237719-the-hacking-of-the-american-mind

https://www.goodreads.com/book/show/34757578-the-hacking-of-the-american-mind

https://www.goodreads.com/book/show/35107643-hacking

https://www.goodreads.com/book/show/35278246-calorie-hacking

https://www.goodreads.com/book/show/36295037-hacking

https://www.goodreads.com/book/show/36430181-hacking-darkness

https://www.goodreads.com/book/show/390866.Hacking_the_Future

https://www.goodreads.com/book/show/39888954-hacking-mexico

https://www.goodreads.com/book/show/40597264-hacking-darwin

https://www.goodreads.com/book/show/42096650-l-arte-dell-hacking

https://www.goodreads.com/book/show/42815289-hacking-kindle-categories-for-fun-and-profit

https://www.goodreads.com/book/show/43359681-hacking-the-code-of-life

https://www.goodreads.com/book/show/61619.Hacking

https://www.goodreads.com/book/show/8622761-hacking-work

https://www.goodreads.com/book/show/895034.Purity_And_Power_Keswick_Ministry_From_Dick_Lucas_Alan_Flavelle_Philip_Hacking_David_Jackman_Others

https://www.goodreads.com/book/show/926312.Hacking_RSS_and_Atom

https://www.goodreads.com/book/show/9311177-kismet-hacking

https://www.goodreads.com/book/show/9407491-hacking-ma-bell

https://www.goodreads.com/author/show/34740.Ian_Hacking

Goodreads author - Ian_Hacking

Move Fast and Break Things: Are Facebook, Amazon, and Google Hacking Our Democracy?

dedroidify.blogspot - defcon-15-t309-hacking-ufology

https://tvtropes.org/pmwiki/pmwiki.php/Main/HackingMinigame

https://tvtropes.org/pmwiki/pmwiki.php/Main/HollywoodHacking

https://en.wikiquote.org/wiki/Ian_Hacking

Ghost in the Shell(1995) - In the year 2029, the barriers of our world have been broken down by the net and by cybernetics, but this brings new vulnerability to humans in the form of brain-hacking. When a highly-wanted hacker known as 'The Puppetmaster' begins involving them in politics, Section 9, a group of cybernetically e...

https://allthetropes.fandom.com/wiki/Hollywood_Hacking

https://dc.fandom.com/wiki/Computer_Hacking

https://dreamfiction.fandom.com/wiki/Firebombing_and_Hacking_of_St._Jude's_High_School

https://iriver.fandom.com/wiki/H10_Hacking_&_Modding

https://moomooio.fandom.com/wiki/Hacking

https://smb-hacking.fandom.com/wiki/Super_Monkey_Ball_Hacking_Wiki

https://tardis.fandom.com/wiki/Hacking

https://twitter.com/share?url=https%3A%2F%2Fwww.fandom.com%2Farticles%2Fhuman-brain-cyberpunk-2077-hacking

https://www.facebook.com/sharer/sharer.php?u=https%3A%2F%2Fwww.fandom.com%2Farticles%2Fhuman-brain-cyberpunk-2077-hacking

https://www.fandom.com/articles/human-brain-cyberpunk-2077-hacking

https://www.reddit.com/submit?url=https%3A%2F%2Fwww.fandom.com%2Farticles%2Fhuman-brain-cyberpunk-2077-hacking

Baldr Force Exe Resolution -- -- Satelight -- 4 eps -- Visual novel -- Action Drama Mecha Sci-Fi -- Baldr Force Exe Resolution Baldr Force Exe Resolution -- Any network runs all over the world, and the development of the information network reaches its acme. In this age, there are two developed worlds; "the real world" and "wired", or the virtual network world. -- -- Soma Toru belongs to a hacking group, Steppen Wolf, which runs around the network world freely. They attack the database of the UN forces as their last work. During this attack, he loses Nonomura Yuya, his friend as well as the team leader. Toru is arrested by the army. In exchange for letting him free, he has to work for an anti-hacker organization, the first squad of the UN Security Force Information Administration Bureau. -- -- Working for them, he is looking for the person who killed his friend, while the other members also have their own reason to fight. -- -- The three-way fights of the terrorist group, the security enterprise, and the army, continue every day. The various events occurred during the fight seem to be independent of each other at the first glance, but they're converging on one event as if they were attracted by something. -- -- Based on the game by GIGA. -- -- (Source: ANN) -- -- Licensor: -- Funimation -- OVA - Nov 10, 2006 -- 15,668 6.46

Battle Programmer Shirase -- -- AIC -- 15 eps -- Original -- Comedy Ecchi Sci-Fi -- Battle Programmer Shirase Battle Programmer Shirase -- Battle Programmer Shirase, also known as BPS, is a free programmer with super hacking abilities who doesn't work for money. What he does work for is certainly something that only people like him would appreciate. But, his demeanor certainly doesn't suit the jobs he is hired for. With the evil King of America causing trouble via the internet, Shirase is nothing but busy as each new adventure brings even more interesting people into the picture. -- -- (Source: ANN) -- -- Licensor: -- Maiden Japan -- TV - Oct 4, 2003 -- 30,537 6.93

Digimon Universe: Appli Monsters -- -- Toei Animation -- 52 eps -- Original -- Action Sci-Fi Adventure Comedy Kids Fantasy -- Digimon Universe: Appli Monsters Digimon Universe: Appli Monsters -- Everyone in the world uses smartphone apps. But inside them lurks unknown creatures called "Appli Monsters," or "Appmon." The Appmon are AI lifeforms with the ability to think and act, and exist in the boundary between the human world and digital space. In the vast sea of the internet, the "last boss AI" Leviathan takes control of the Appmon with a virus and begins hacking every system, thus starting to control the human world from the world of the net. Haru Shinkai is led to acquire the Appli Drive, and uses it to materialize Gatchmon, a search app monster. -- -- (Source: ANN) -- 11,498 6.58

High School Agent -- -- J.C.Staff -- 2 eps -- Manga -- Action Drama Military -- High School Agent High School Agent -- Based on a manga by Tanimura Hitoshi, serialized in Comic Burger. -- -- Teenager Kanemori Kousuke is a secret agent for the international VN spy network. Using his computer hacking skills, he tracks international criminals. Later he goes after Neo-Nazis to the Arctic were they try to raise a U-boat with a sinister secret. -- -- (Source: The Anime Encyclopedia) -- OVA - Jul 1, 1987 -- 947 5.47

https://wiki.archlinux.org/index.php/Wii_hacking

200911 News of the World phone hacking scandal investigations

Automotive hacking

Baron Hacking

Billboard hacking

Biohacking

Blue chip hacking scandal

Bob Hacking

Body hacking

Douglas Hacking, 1st Baron Hacking

Google hacking

Government hacking

Growth hacking

Hacking

Hacking at Random

Hacking knife

Hacking Matter

Hacking of consumer electronics

Hacking: The Art of Exploitation

Happy Hacking Keyboard

Ian Hacking

Jamie Hacking

John Hacking

Legion of Doom (hacking)

Level Seven (hacking group)

List of documents relating to the News International phone hacking scandal

List of investigations, resignations, suspensions, and dismissals in conjunction with the news media phone hacking scandal

List of people arrested in the News International phone-hacking scandal

List of people related to the News International phone hacking scandal

List of security hacking incidents

List of victims of the News International phone hacking scandal

Metropolitan Police role in the news media phone hacking scandal

Murder of Lori Hacking

News International phone hacking scandal

News media phone hacking scandal reference lists

Patriotic hacking

Philip Hacking

Phone hacking

Port Hacking

ROM hacking

Roof and tunnel hacking

Social hacking

The Secret History of Hacking

Vietnamese airports hackings

Whacking Day