classes ::: subject, programming, Computer_Science,
children :::
branches ::: Hacking

Instances, Classes, See Also, Object in Names
Definitions, . Quotes . - . Chapters .


object:Hacking
class:subject
class:programming
class:Computer Science
potential targets ::: (without this why learn?)
Major IP Addresses Blocks By Country ::: nirsoft.net/countryip/
nslookup theinfinitelibrary.net
Proper IP scan ::: nmap -oG - 192.168.0.0-255 -vv > temp-nmap-local-1
## this actually grants some good info like this
  Host: 192.168.0.1 (dlinkrouter) Status: Up
  Host: 192.168.0.1 (dlinkrouter) Ports: 53/open/tcp//domain///, 80/open/tcp//http///, 443/open/tcp//https///, 49152/open/tcp//unknown/// Ignored State: closed (996)
  Host: 192.168.0.147 () Status: Up
  Host: 192.168.0.147 () Ports: 6547/filtered/tcp//powerchuteplus/// Ignored State: closed (999)
  Host: 192.168.0.184 () Status: Up
  Host: 192.168.0.184 () Ports: 62078/open/tcp//iphone-sync/// Ignored State: closed (999)
  Host: 192.168.0.188 () Status: Up
  Host: 192.168.0.188 () Ports: 22/open/tcp//ssh/// Ignored State: closed (999)

FAST SCAN ::: nmap -F 192.168.0.0-255
dmitry -p 192.168.0.1
sudo vim /etc/proxychains.conf
macchanger -s wlp1s0 gets current and permanent MAC
GETS MANUFACTURING INFO ::: checkmac() { curl "https://hwaddress.com/oui-iab/$*/"; } ## example checkmac 60:57:18

see also ::: network, the Matrix, Westworld




questions, comments, suggestions/feedback, take-down requests, contribute, etc
contact me @ integralyogin@gmail.com or via the comments below
or join the integral discord server (chatrooms)
if the page you visited was empty, it may be noted and I will try to fill it out. cheers



--- OBJECT INSTANCES [0]


--- PRIMARY CLASS


Computer_Science
programming
subject

--- SEE ALSO


network
the_Matrix
Westworld

--- SIMILAR TITLES [1]


Hacking
select ::: Being, God, injunctions, media, place, powers, subjects,
favorite ::: cwsa, everyday, grade, mcw, memcards (table), project, project 0001, Savitri, Savitri (extended toc), the Temple of Sages, three js, whiteboard,
temp ::: consecration, experiments, knowledge, meditation, psychometrics, remember, responsibility, temp, the Bad, the God object, the Good, the most important, the Ring, the source of inspirations, the Stack, the Tarot, the Word, top priority, whiteboard,

--- DICTIONARIES (in Dictionaries, in Quotes, in Chapters)


hacking ::: p. pr. & vb. n. --> of Hack

hacking run
(Analogy with "bombing run" or "speed run") A hack
session extended long outside normal working times, especially
one longer than 12 hours. May cause you to "change {phase}
the hard way".
[{Jargon File}]
(1996-08-26)

Hacking X for Y
[ITS] Ritual phrasing of part of the information which ITS
made publicly available about each user. This information
(the INQUIR record) was a sort of form in which the user could
fill out various fields. On display, two of these fields were
always combined into a project description of the form
"Hacking X for Y" (e.g. ""Hacking perceptrons for Minsky"").
This form of description became traditional and has since been
carried over to other systems with more general facilities for
self-advertisement (such as Unix {plan files}).
[{Jargon File}]

hacking ::: p. pr. & vb. n. --> of Hack

hacking run ::: (jargon) (Analogy with bombing run or speed run) A hack session extended long outside normal working times, especially one longer than 12 hours. May cause you to change phase the hard way.[Jargon File] (1996-08-26)

Hacking X for Y ::: [ITS] Ritual phrasing of part of the information which ITS made publicly available about each user. This information (the INQUIR record) was a sort of became traditional and has since been carried over to other systems with more general facilities for self-advertisement (such as Unix plan files).[Jargon File]


--- QUOTES [1 / 1 - 389 / 389] (in Dictionaries, in Quotes, in Chapters)



KEYS (10k)

   1 Kevin Mitnick

NEW FULL DB (2.4M)

   42 Ian Hacking
   12 Ryan Holiday
   12 Kevin Mitnick
   9 Stephen R Covey
   7 Reince Priebus
   7 Anonymous
   7 Amy Poehler
   6 Donald Trump
   6 Barack Obama
   5 Rick Riordan
   5 Neal Stephenson
   5 Michael Demon Calce
   4 Wendelin Van Draanen
   4 Henry David Thoreau
   3 Tim Cook
   3 Rush Limbaugh
   3 Roger Stone
   3 Richard Stallman
   3 J K Rowling
   3 Fred Kaplan
   3 Edward Snowden
   3 Cassandra Clare
   3 Bruce Schneier
   2 Ursula K Le Guin
   2 Timothy Ferriss
   2 Seth Lloyd
   2 Richelle Mead
   2 Paul Graham
   2 Noam Chomsky
   2 Nancy Pelosi
   2 Matthew Quick
   2 Markus Zusak
   2 Margot Lee Shetterly
   2 Luke Harding
   2 Lisa Kleypas
   2 Jonathan Wilson
   2 John Lewis
   2 John Kasich
   2 John Green
   2 John Flanagan
   2 Hillary Clinton
   2 Elizabeth LaBan
   2 E J Dionne
   2 Douglas Rushkoff
   2 David Corn
   2 Daniel Domscheit Berg
   2 Damon Knight
   2 C S Lewis
   2 Charles Bukowski
   2 Carl Sandburg
   2 Alyxandra Harvey
   2 Alan Watts
   2 Adri n Lamo

1:My primary goal of hacking was the intellectual curiosity, the seduction of adventure. ~ Kevin Mitnick,

*** NEWFULLDB 2.4M ***

1:idea of whacking the hippo. ~ Stuart Gibbs,
2:Handed Down In High-Profile Phone Hacking Case ~ Anonymous,
3:Acceptance means commitment, among other things. ~ Ian Hacking,
4:Growth HAcking is more of a mindset that a tool kit ~ Ryan Holiday,
5:German reminded her of an old man hacking up phlegm. ~ Sara Shepard,
6:Death is hacking away at my address book and party lists. ~ Mason Cooley,
7:Each of us becomes a new person as we redescribe the past. ~ Ian Hacking,
8:Growth hacking really is a mindset rather than a tool kit. ~ Ryan Holiday,
9:Anyway, whacking a surly bartender ain't much of a crime. ~ Larry McMurtry,
10:The Atlantic con el título: «Hacking the President’s DNA». Si ~ Timothy Ferriss,
11:People are running huge enterprises off of hacking and stealing data. ~ Tim Cook,
12:As we have seen, bacteria have ways of hacking into the nervous system. ~ Ed Yong,
13:You can do reverse engineering, but you can’t do reverse hacking. ~ Francis Crick,
14:As a young boy, I was taught in high school that hacking was cool. ~ Kevin Mitnick,
15:You have no idea whether the hacking even influenced the election. ~ Reince Priebus,
16:If somebody's hacking you, you don't want them to know that you know. ~ Nancy Pelosi,
17:Probability fractions arise from our knowledge and from our ignorance. ~ Ian Hacking,
18:The final arbitrator in philosophy is not how we think but what we do. ~ Ian Hacking,
19:The Russians stole from the Democratic National Committee with hacking. ~ E J Dionne,
20:It's less about technology for me, and more about religion. [on hacking] ~ Adri n Lamo,
21:It’s not about hacking computers anymore; it’s about hacking human souls. ~ John Green,
22:In each case you settle on an act. Doing nothing at all counts as an act. ~ Ian Hacking,
23:Opinion is the companion of probability within the medieval epistemology. ~ Ian Hacking,
24:Who, Coach Hedge? He’d try to fix Jason by whacking him upside the head. ~ Rick Riordan,
25:The best reaction to a paradox is to invent a genuinely new and deep idea. ~ Ian Hacking,
26:hacking the website of an academic journal to change the referees’ reports. ~ Jean Tirole,
27:Hillary Clinton has taught us really how vulnerable we are in cyber hacking. ~ Donald Trump,
28:Statistics began as the systematic study of quantitative facts about the state. ~ Ian Hacking,
29:In their view, hacking would be better served by using the best system possible. ~ Steven Levy,
30:Playfully doing something difficult, whether useful or not, that is hacking. ~ Richard Stallman,
31:love to give someone a concussion from whacking them on the head with knowledge. ~ Angela Pepper,
32:Air warfare is a shot through the brain, not a hacking to pieces of the enemy's body. ~ J F C Fuller,
33:What's hard, in hacking as in fiction, is not writing, it's deciding what to write. ~ Neal Stephenson,
34:For every thousand hacking at the leaves of evil, there is one striking at the root. ~ Stephen R Covey,
35:My primary goal of hacking was the intellectual curiosity, the seduction of adventure. ~ Kevin Mitnick,
36:[ Cyber hacking] that's probably the only thing that we've learned from Hillary Clinton. ~ Donald Trump,
37:Despair leads to boredom, electronic games, computer hacking, poetry and other bad habits. ~ Edward Abbey,
38:for every thousand hacking at the leaves of evil , there is one hacking at the root .... ~ Stephen R Covey,
39:For every thousand hacking at the leaves of evil, there is one striking at the root.” We ~ Stephen R Covey,
40:A lot of hacking is playing with other people, you know, getting them to do strange things. ~ Steve Wozniak,
41:Underground: Tales of Hacking, Madness and Obsession from the Electronic Frontier—a ~ Daniel Domscheit Berg,
42:When I was hacking, it was more pushing the status quo and seeing how far you can go. ~ Michael Demon Calce,
43:Back in my era, hacking was all about messing with other hackers. It was a hacker war. ~ Michael Demon Calce,
44:Plutonium has a quite extraordinary relationship with people. They made it, and it kills them. ~ Ian Hacking,
45:There are thousand hacking at the branches of evil to one who is striking at the root. ~ Henry David Thoreau,
46:Whereas marketing was once brand-based, with growth hacking it becomes metric and ROI driven. ~ Ryan Holiday,
47:I could have evaded the FBI a lot longer if I had been able to control my passion for hacking. ~ Kevin Mitnick,
48:There are a thousand hacking at the branches of evil to one who is striking at the root. ~ Henry David Thoreau,
49:For every thousand hacking at the leaves of evil, there is one striking at the root - Thoreau ~ Stephen R Covey,
50:for every thousand people hacking at the leaves of evil, there is one striking at the roots. ~ Stephen M R Covey,
51:By legend and perhaps by nature philosophers are more accustomed to the armchair than the workbench. ~ Ian Hacking,
52:Molecular biology has routinely taken problematic things under its wing without altering core ideas. ~ Ian Hacking,
53:director of growth at StumbleUpon, put it best: growth hacking is more of a mindset than a tool kit. ~ Ryan Holiday,
54:people hack into the library to rehearse hacking into bigger, more secure, and more valuable targets. ~ Susan Orlean,
55:The Democratic Party would like to see an open independent bipartisan investigation [about hacking]. ~ Donna Brazile,
56:Welcome to the future, Holmesy. It’s not about hacking computers anymore; it’s about hacking human souls. ~ John Green,
57:When land and its tillage are the basis of taxation, one need not care exactly how many people there are. ~ Ian Hacking,
58:America has abandoned the strong woman of spirituality and is shacking up with the harlot of materialism. ~ Joseph Losey,
59:If you were just intent on killing people you could do better with a bomb made of agricultural fertiliser. ~ Ian Hacking,
60:Many modern philosophers claim that probability is relation between an hypothesis and the evidence for it. ~ Ian Hacking,
61:Until the seventeenth century there was no concept of evidence with which to pose the problem of induction! ~ Ian Hacking,
62:I don't want anyone hacking us. And I'm not only talking about countries. I'm talking about anyone, period. ~ Donald Trump,
63:For every thousand hacking at the leaves of evil, there is one striking at the root.” We can only achieve ~ Stephen R Covey,
64:I left the room in a daze, wondering if this was all real-or if I'd finally gone insane from whacking the weasel. ~ Sam Torode,
65:Hacking is very interesting. Once they hack, if you don't catch them in the act, you're not going to catch them. ~ Donald Trump,
66:In the words of Thoreau, “For every thousand hacking at the leaves of evil, there is one striking at the root. ~ Stephen R Covey,
67:Artemis felt like he was six again and caught hacking the school computers trying to make the test questions harder ~ Eoin Colfer,
68:Kate had never met a person she didn't want to protect, preferably by hacking at the hostile parties with her sword. ~ Ilona Andrews,
69:Hacking into a victim of crime's phone is a sort of poetically elegant manifestation of a modus operandi the tabloids have. ~ Steve Coogan,
70:The intent of the individuals who created the DDoS attacks has nothing to do with hacking, and they are vandals, not hackers. ~ Kevin Mitnick,
71:Any given study seems to prove a lot, but put together, they are so at odds with each other that the net effect is inconclusive. ~ Ian Hacking,
72:I went to prison for my hacking. Now people hire me to do the same things I went to prison for, but in a legal and beneficial way. ~ Kevin D Mitnick,
73:The administration [of Barack Obama] is going to have to figure out, you know, a tough response on the basis of this [Russian] hacking. ~ John Kasich,
74:Every once in a while, something happens to you that makes you realise that the human race is not quite as bad as it so often seems to be. ~ Ian Hacking,
75:China is stealing our intellectual property, our patents, our designs, our technology, hacking into our computers, counterfeiting our goods. ~ Mitt Romney,
76:Governments almost never admit to hacking each other’s computers. Researchers generally infer the country of origin from the target list. ~ Bruce Schneier,
77:I’m not…” He paused. “I’m here. I’m staying here, by your side. This is more than just two people shacking up together. This is so much more. ~ Karina Halle,
78:It's clear why hacking communities are [growing]. Because it's like, there's a lot more gold there. There's a lot more to steal than ever before. ~ Tim Cook,
79:Plucking your hair and collecting your snot and nail clippings is one thing, but hacking off a finger to make a damned puppet is insane ~ Michael R Fletcher,
80:Henry narrowed his eyes at me. "You going somewhere?"
"Lacrosse field trip," I said. "I enjoy whacking the hell out of people with mallets. ~ Robin Benway,
81:the very phenomenon being investigated may be changed by the inquiry itself. It is as if there were a principle of human indeterminacy at work. ~ Ian Hacking,
82:What was he supposed to do besides break the living room window? Stand outside whacking off while she grabbed a cell phone and called for help? ~ Jeff Strand,
83:hacking in its pure form stretched back centuries. It wasn't restricted to a single medium. It was more than a methodology. It was an ethos. ~ Robin Wasserman,
84:A single observation that is inconsistent with some generalization points to the falsehood of the generalization, and thereby 'points to itself'. ~ Ian Hacking,
85:Women, on the other hand, had to wield their intellects like a scythe, hacking away against the stubborn underbrush of low expectations. ~ Margot Lee Shetterly,
86:I am not a wishing well with legs.
(Paraphrasing Babylon 5's Londo Mollari, repeately, when asked to perform hacking functions for strangers.) ~ Adri n Lamo,
87:It was the kind of talk that made me want to break off a limb and take to whacking her and that bunch of hypocrites across the back of the head. ~ Joe R Lansdale,
88:We contacted the FBI months ago, when the DNC issue came about. They've reviewed all of our systems. We have hacking detection systems in place. ~ Reince Priebus,
89:My actions constituted pure hacking that resulted in relatively trivial expenses for the companies involved, despite the government's false claims. ~ Kevin Mitnick,
90:The smartest hackers understand that their skill at hacking technology may be less important than their skill at hacking the digital marketplace. ~ Douglas Rushkoff,
91:People sometimes ask me if it is a sin in the Church of Emacs to use vi. Using a free version of vi is not a sin; it is a penance. So happy hacking. ~ Richard Stallman,
92:We favor hypotheses for their simplicity and explanatory power, much as the architect of the world might have done in choosing which possibility to create. ~ Ian Hacking,
93:WHAT IS GROWTH HACKING? The end goal of every growth hacker is to build a self-perpetuating marketing machine that reaches millions by itself. —AARON GINN ~ Ryan Holiday,
94:At Google, engineers were offered a class called “Neural Self-Hacking.” An article in Wired magazine referred to meditation as the tech world’s “new caffeine. ~ Dan Harris,
95:I don't even have any good skills. You know like nunchuck skills, bow hunting skills, computer hacking skills. Girls only want boyfriends who have great skills! ~ Jon Heder,
96:A lot of people would enter restricted sites just to say they can, and then log out. Today, everything related to hacking seems to be for monetary gain. ~ Michael Demon Calce,
97:Hackers are breaking the systems for profit. Before, it was about intellectual curiosity and pursuit of knowledge and thrill, and now hacking is big business. ~ Kevin Mitnick,
98:I felt a light whacking at my legs.
"Sturdy calves. She'll carry a child nicely," said Marta… "Sprog her up before I die, Nicky boy. I assume you know how. ~ Heather Cocks,
99:I have this extraordinary curiosity about all subjects of the natural and human world and the interaction between the physical sciences and the social sciences. ~ Ian Hacking,
100:The truth is revealed by removing things that stand in its light, an art not unlike sculpture, in which the artist creates, not by building, but by hacking away. ~ Alan Watts,
101:He’s got amnesia or something,” Piper said. “We’ve got to tell somebody.” Leo scoffed. “Who, Coach Hedge? He’d try to fix Jason by whacking him upside the head. ~ Rick Riordan,
102:In the hacking world, security is more of a response than a proactive measure. They wait for hackers to attack and then they patch, based on the attacks. ~ Michael Demon Calce,
103:Pigpen crosses his arms over his chest, clearly pissed that I'm not following his set of rules for hacking. "You should have come to me when you hit that snag. ~ Katie McGarry,
104:From any vocabulary of ideas we can build other ideas by formal combinations of signs. But not any set of ideas will be instructive. One must have the right ideas. ~ Ian Hacking,
105:A 2014 conference on hacking in Las Vegas. The private sector spent $665 million on data loss prevention last year, according to the technology research firm Gartner. ~ Anonymous,
106:Randy was forever telling people, without rancor, that they were full of shit. That was the only way to get anything done in hacking. No one took it personally. ~ Neal Stephenson,
107:There are two ways in which a science develops; in response to problems which is itself creates, and in response to problems that are forced on it from the outside. ~ Ian Hacking,
108:We'll just have to meet him off campus," I said. "Do your hacker thing and get a hold of him."
Chloe rolled her eyes. "It's called a phone. No hacking required. ~ Alyxandra Harvey,
109:I hope that this [hacking] does not continue to be viewed purely through a partisan lens.I think there are Republicans as well as Democrats who are concerned about this. ~ Barack Obama,
110:using playful cleverness to achieve a goal.” Hacking away at something in small chunks or reprogramming bits and pieces of the media is what will define the future of media. ~ Mitch Joel,
111:If somebody's hacking you, you don't want them to know that you know. You want to find out what they're doing, how they're doing it, and then you'll let them know you know. ~ Nancy Pelosi,
112:I have told people that writing this book has been like brushing away dirt from a fossil. What a load of shit. It has been like hacking away at a freezer with a screwdriver. ~ Amy Poehler,
113:I was addicted to hacking, more for the intellectual challenge, the curiosity, the seduction of adventure; not for stealing, or causing damage or writing computer viruses. ~ Kevin Mitnick,
114:With growth hacking, we begin by testing until we can be confident we have a product worth marketing. Only then do we chase the big bang that kick-starts our growth engine. ~ Ryan Holiday,
115:There is no canonical way to think of our own past. In the endless quest for order and structure, we grasp at whatever picture is floating by and put our past into its frame. ~ Ian Hacking,
116:At any time, people suffering severe psychological distress that is not of organic or other biological origin "choose" from socially available and clinically reinforced modes. ~ Ian Hacking,
117:Sometimes we do not really become adults until after we suffer a good whacking loss, and our lives in a sense catch up with us and wash over us like a wave and everything goes ~ Richard Ford,
118:We want to protect American interests. It's America first. I don't want the D.N.C. hacked. I don't want anybody hacked. But I don't know who did the hacking. That's my point. ~ Reince Priebus,
119:I think something will soon have to be done to protect people from hacking and blogging and lying and spreading rumors and chasing you down the street. Lives are wrecked that way. ~ Ali MacGraw,
120:In hacking, like painting, work comes in cycles. Sometimes you get excited about a new project and you want to work sixteen hours a day on it. Other times nothing seems interesting. ~ Paul Graham,
121:There are good ways and bad ways to get my attention. Whacking on my ego with a crowbar will get my attention, sure, but it's not going to leave me well disposed to the messenger. ~ Charles Stross,
122:An amazing thing about our digital age is that the person next to you at Starbucks might just be hacking into a Swiss bank or launching multiwarhead nuclear missiles continents away. ~ Scott Berkun,
123:Which [the cyber hacking] is why one of the first things we must do is to enforce all classification rules and to enforce all laws relating to the handling of classified information. ~ Donald Trump,
124:I still am mystified about why Donald Trump is out there tweeting praise of Vladimir Putin, and still kind of denying and dismissing whether the hacking happened or the seriousness of it. ~ David Corn,
125:The truth is revealed by removing things that stand in its light, an art not unlike sculpture, in which the artist creates, not by building, but by hacking away. ~ Alan Watts, The Wisdom of Insecurity,
126:While there were many factors in the 2016 election, from false news to voter suppression and Russian hacking, the question is why so many people responded to Donald Trump's demagoguery. ~ Riane Eisler,
127:Perplexity isn’t as noble as conviction, but perhaps more good is done in the name of muddling through uncertainty than is done hacking away with the righteous sword of self-confidence. ~ Gregory Maguire,
128:I'm interested to see what happens with Fox News and phone hacking. I really can't believe it just happens in Great Britain. Because really, who cares about just hacking phones over there? ~ Michael Moore,
129:I’m not going to be able to sleep a wink tonight.
I hate shelters.
People coughing and snoring and hacking up who-knows-what.
It’s a nightmare.
But I do have clean teeth. ~ Wendelin Van Draanen,
130:Watching a documentary with people hacking their way through some polar wasteland is merely a visual. Actually trying to deal with cold that can literally kill you is quite a different thing. ~ Henry Rollins,
131:Listen up. Let me tell you something. A man ain’t a goddamn ax. Chopping, hacking, busting every goddamn minute of the day. Things get to him. Things he can’t chop down because they’re inside. ~ Toni Morrison,
132:had believed—until the past couple of weeks—that the world was his personal puzzle, and that any riddlings and unravelings he could perform, including computer hacking, were simply part of his nature. ~ Greg Bear,
133:said. "Let's remember that half the people in this state have camcorders, and they'd just love a chance to earn ten grand selling the tabloids pictures of one of us whacking some coon upside the head. ~ Anonymous,
134:motherhood seemed like a very long game of Whac-A-Mole to her—that crazy game at the arcade where you had to keep whacking the moles to win. You just manage to control one and the next one pops u ~ Elizabeth LaBan,
135:motherhood seemed like a very long game of Whac-A-Mole to her—that crazy game at the arcade where you had to keep whacking the moles to win. You just manage to control one and the next one pops up ~ Elizabeth LaBan,
136:You always start with a fantasy. Part of the fantasy technique is to visualize something as perfect. Then with the experiments you work back from the fantasy to reality, hacking away at the components. ~ Edwin Land,
137:My parents may never recover from the trauma of having to ask me to put my hacking skills to good use after dissuading me from using them all these years.
—from the journal of Payton Marcus Townsend ~ J L Langley,
138:I got so passionate about technology. Hacking to me was like a video game. It was about getting trophies. I just kept going on and on, despite all the trouble I was getting into, because I was hooked. ~ Kevin Mitnick,
139:The Russians sought to interfere with the election process - that the cyber hacking that took place by the Russians was part of that campaign, and that they had a clear preference in terms of outcomes. ~ Barack Obama,
140:We can only achieve quantum improvements in our lives as we quit hacking at the leaves of attitude and behavior and get to work on the root, the paradigms from which our attitudes and behaviors flow. ~ Stephen R Covey,
141:A lot of people think Barack Obama should have responded to the Russian hacking of the U.S. elections weeks ago, months ago. So these happened on his watch. There's nothing wrong with him dealing with it. ~ David Brooks,
142:Even I have lied about writing. I have told people that writing this book has been like brushing away dirt from a fossil. What a load of shit. It has been like hacking away at a freezer with a screwdriver. ~ Amy Poehler,
143:It doesn’t matter how many people know about you or how they find out about you. It matters how many sign up. If handing out flyers on the street corner accomplishes that, then consider it growth hacking. ~ Ryan Holiday,
144:There are two basic ways to criticize an argument:
■ Challenge the premises-show that at least one is false.
■ Challenge the reasoning-show that the premises are not a good reason for the conclusion. ~ Ian Hacking,
145:Cutting up fowl to predict the future is, if done honestly and with as little interpretation as possible, a kind of randomization. But chicken guts are hard to read and invite flights of fancy or corruption. ~ Ian Hacking,
146:Thers is this wonderful iconoclast at Rutgers, Doron Zeilberger, who says that our mathematics is the result of a random walk, by which he means what WE call mathematics. Likewise, I think, for the sciences. ~ Ian Hacking,
147:If you want to test a woman’s capacity to really get shit done, get her sick. You’d be amazed at what a coughing, hacking, feelinglike-hell female can accomplish.” What? They don’t exist? Exactly my point. ~ Jenna McCarthy,
148:I talked with the old guy behind the counter about the Packers and how with Rodgers at the helm they’d see a Super Bowl soon. He agreed and relayed his dismay over Favre’s betrayal by shacking up with the Vikings. ~ L T Ryan,
149:Grimly, she realized that clocks don't make a sound that even remotely resembles ticking, tocking. It was more the sound of a hammer, upside down, hacking methodically at the earth. It was the sound of a grave. ~ Markus Zusak,
150:And the conviction stands that there must be knowledge to be had, if only we could get it. Perhaps that is what is wrong: an assumption about the possibility of knowledge and the kind of knowledge that it must be. ~ Ian Hacking,
151:I'm still a hacker. I get paid for it now. I never received any monetary gain from the hacking I did before. The main difference in what I do now compared to what I did then is that I now do it with authorization. ~ Kevin Mitnick,
152:Why should there be the method of science? There is not just one way to build a house, or even to grow tomatoes. We should not expect something as motley as the growth of knowledge to be strapped to one methodology. ~ Ian Hacking,
153:An interactive debugger is an outstanding example of what is not needed - it encourages trial-and-error hacking rather than systematic design, and also hides marginal people barely qualified for precision programming. ~ Harlan Mills,
154:My brief exchange with Guccifer 2 is six weeks after the hacking of the and publication of the DNC documents, which I'm accused of colluding with him on. In other words, I would need a time machine in order to collude. ~ Roger Stone,
155:When you zap things with light to build quantum computers, you're hacking existing systems. You're hijacking the computation that's already happening in the universe, just like a hacker takes over someone else's computer. ~ Seth Lloyd,
156:Steele’s sources offered one final piece of devastating information. They alleged that Trump’s team had coordinated with Russia on the hacking operation against Clinton. And that the Americans had secretly co-paid for it. ~ Luke Harding,
157:Causes are objects of knowledge, and child abuse could be the cause of an illness only if it was something like what is called a natural kind, a kind of event found in nature and hooked up to other events by laws of nature. ~ Ian Hacking,
158:No one can say that this was the decisive and [Russians hacking ] was what elected [Donald] Trump, but clearly his behavior during the campaign in terms of what he said in the week or two before the election was unacceptable. ~ John Lewis,
159:Chocolate in the library!” she screamed. “Out — out — OUT!” And whipping out her wand, she caused Harry’s books, bag, and ink bottle to chase him and Ginny from the library, whacking them repeatedly over the head as they ran. ~ J K Rowling,
160:The NSA was hacking into Chinese networks to help defeat them in a war; China was hacking into American networks mainly to help enrich its economy. What made one form of hacking permissible and the other form intolerable? Even ~ Fred Kaplan,
161:I think [Donald Trump] is going to be inaugurated this week. I have great concerns, and apparently Republicans do as well, and there's going to be an investigation about the role that Russian hacking played in getting him elected. ~ John Lewis,
162:Much early alchemy seems to have been adventure. You heated and mixed and burnt and pounded and to see what would happen. An adventure might suggest an hypothesis that can subsequently be tested, but adventure is prior to theory. ~ Ian Hacking,
163:Everything else just kept picking and picking, hacking away. And nothing was interesting, nothing. The people were restrictive and careful, all alike. And I've got to live with these fuckers for the rest of my life, I thought. ~ Charles Bukowski,
164:Experimental work provides the strongest evidence for scientific realism. This is not because we test hypotheses about entities. It is because entities that in principle cannot be 'observed' are manipulated to produce a new phenomena ~ Ian Hacking,
165:If we get to a point where people in this country feel more affinity with a leader who is an adversary and view the United States and our way of life as a threat to him, then we're gonna have bigger problems than just cyber hacking. ~ Barack Obama,
166:It is not in the marketing industry’s DNA to be any of the following things, which are critical to growth hacking: In-house Lean/efficient Trackable Internal (that is product development) over external (public facing/attention seeking) ~ Ryan Holiday,
167:Many cyberweapons manufacturers sell hacking tools to governments worldwide. For example, FinFisher is an “offensive IT Intrusion solution,” according to the promotional material from the UK and German company that makes it, Gamma Group. ~ Bruce Schneier,
168:This was a big leak that WikiLeaks published, and it was hacking software developed by the CIA and the FBI that was able to leave fingerprints of other countries. So the CIA could hack our election to make it look like the Russians did it. ~ Rush Limbaugh,
169:Our intelligence communities spend a lot of time and effort gathering a lot of strands and a lot of data [on Russian hacking]. There are times where they're very cautious and they say, "We think this is what happened, but we're not certain." ~ Barack Obama,
170:Mike Myatt’s ‘Hacking Leadership’ is a must read… Mike combines insightful yet practical commentary with in the trenches leadership experience few can match. I would highly recommend this text to anyone looking to become a better leader. ~ Vijay Govindarajan,
171:Look, Sage. I don't know much about chemistry or computer hacking or photosynthery, but this is something I've got a lot of experience with." I think he mean photosynthesis, but I didn't correct him. "Use my knowledge. Don't let it go to waste. ~ Richelle Mead,
172:A pathfinder's job is hard enough — blazing trails where there are none, guided by nothing but hearsay and gut. While you're hacking your way through bracken, worrying about lurking beasts, all you can do is hope you had chosen the right direction. ~ Justina Chen,
173:Hackers are unruly. That is the essence of hacking. And it is also the essence of Americanness. It is no accident that Silicon Valley is in America, and not France, or Germany, or England, or Japan. In those countries, people color inside the lines. ~ Paul Graham,
174:It's true, I had hacked into a lot of companies, and took copies of the source code to analyze it for security bugs. If I could locate security bugs, I could become better at hacking into their systems. It was all towards becoming a better hacker. ~ Kevin Mitnick,
175:Don't you know alcohol kills brain cells...any damn brain cell that can't live through a good drunk deserves to die. You're doing yourself a favour, getting rid of all them nonhacking, underachieving ones. I'm working on improving your efficiency. ~ James E Webb,
176:It’s the same something feared by any ass-kicker who finds himself in medias res, hacking through the thick of it, knee-deep in the dead. He feared that, were he ever to stop, the mind he needed to keep trained on a target might instead turn on him. ~ Kent Russell,
177:With hacking getting more and more sophisticated, the hacking community has gone from the hobbyist in the basement to huge sophisticated companies that are essentially doing this, or groups of people or foreign agents inside and outside the United States. ~ Tim Cook,
178:You... don't have the spine!" he hissed with morbid, sadistic amusement.

Unfortunately for him, it was mercy that I lacked, not a spine. I raised my swords high overhead. He stopped laughing when I had finished hacking off his head. ~ Courtney Allison Moulton,
179:At Newsweek, I get paid to meet amazing people and write about subjects that fascinate me: fusion energy, education reform, supercomputing, artificial intelligence, robotics, the rising competitiveness of China, the global threat of state-sponsored hacking. ~ Dan Lyons,
180:Ruminants are a perfectly normal thing to possess when you live in upstate New York. It's just moving scenery. It's kind of like the equivalent of Great Danes. It's the way you keep your grass mowed. It's the way you keep your weed-whacking to a minimum. ~ Vera Farmiga,
181:It’s actually a smarter crime because imagine if you rob a bank, or you’re dealing drugs. If you get caught you’re going to spend a lot of time in custody. But with hacking, it’s much easier to commit the crime and the risk of punishment is slim to none. ~ Kevin Mitnick,
182:Now that I thought of it, perhaps whacking the burglar wasn’t quite…necessary.
It occurred to me that he said “Hi.” I thought he did, anyway. He said hi. Do burglars usually
greet their victims? Hi. I’d like to rob your house. Does that work for you? ~ Kristan Higgins,
183:Didn't he come to—to ask you for some magic?"
"No, he came to enjoy the view of the Wood," the Dragon said. "Of course he came for magic, and I sent him about his business, which is hacking at enemy knights and not meddling in things he scarcely understands. ~ Naomi Novik,
184:The Trojan war is not and you cannot make it be the War of Good vs. Evil. It’s just a war, a wasteful, useless, needless, stupid, protracted, cruel mess full of individual acts of courage, cowardice, nobility, betrayal, limb-hacking-off, and disembowelment. ~ Ursula K Le Guin,
185:A layer of fine powder coats his skin.
“My lungs are turning to concrete,” Rob wheezes, hacking and spitting.
“So are my eyes. How do I always get roped into these things?” Avery coughs and pats Rob’s back in sympathy. A poof of dust billows from the contact. ~ Laura Kreitzer,
186:Reports the CIA has concluded that Russian hacking of Democratic emails was aimed at helping Donald Trump defeat Hillary Clinton, a step beyond the intelligence community's earlier finding that Russia was simply trying to cast doubt on the integrity of our elections. ~ Donald Trump,
187:He knew from hacking Human laptops that all their passwords were slight variations on a single theme—either their limited noses kept them ignorant to the threats swirling all around them, or they just couldn’t hold more than a few tidbits in their brains at any one time. ~ Hugh Howey,
188:Blade, she thought. I swallowed it; now cuts my loins forever. Punishment. Married to a Jew and shacking up with a German assassin. She felt tears again in her eyes, boiling. For all I have committed. Wrecked. 'Let's go,' she said, rising to her feet. 'The hairdresser. ~ Philip K Dick,
189:Computer hacking really results in financial losses and hassles. The objectives of terrorist groups are more serious. That is not to say that cyber groups can't access a telephone switch in Manhattan on a day like 9/11, shut it down, and therefore cause more casualties. ~ Kevin Mitnick,
190:Cyber security will be an issue that I will be absolutely focused on as president. Because whether it's Russia, or China, Iran or North Korea more and more countries are using hacking to steal our information, to use it to their advantage. And we can't let that go on. ~ Hillary Clinton,
191:According to Grandad, being a vegetarian wasn't about just health or cruelty of money or flavor: it was about manners. He said that stealing milk and eggs and honey was enough of a liberty without hacking off someone's leg and then drowning it in gravy. He had a point. ~ Jenny Valentine,
192:A lie is no less a lie because it is a thousand years old. Your undivided church has liked nothing better than persecuting its own members, burning them and hacking them apart when they stood by their own conscience, slashing their bellies open and feeding their guts to dogs. ~ Hilary Mantel,
193:Let's finish with Guccifer. My communication with him is now entirely public. It is benign.Secondarily, the timing of my communication is after, not before, I write a story for Breitbart regarding the hacking. And I never defend him from not being a Russian agent in that piece. ~ Roger Stone,
194:There are a thousand hacking at the branches of evil to one who is striking at the root, and it may be that he who bestows the largest amount of time and money on the needy is doing the most by his mode of life to produce that misery which he strives in vain to relieve. ~ Henry David Thoreau,
195:What the US does is the kind of thing I described in Italy in 1948. Case after case like that, not hacking or spreading rumors in the media; but saying look, we're going to starve you to death or kill you or destroy you unless you vote the way we want. I mean that's what we do. ~ Noam Chomsky,
196:If the AI has (perhaps for safety reasons) been confined to an isolated computer, it may use its social manipulation superpower to persuade the gatekeepers to let it gain access to an Internet port. Alternatively, the AI might use its hacking superpower to escape its confinement. ~ Nick Bostrom,
197:There are proxies, proxy servers on the internet, and this is very typical for hackers to use. They create what are called proxy chains where they gain access to a number of different systems around the world, sometimes by hacking these, and they use them as sort of relay boxes. ~ Edward Snowden,
198:Google did a great job hacking the Web to create search - and then monetizing search with advertising. And Apple did a great job humanizing hardware and software so that formerly daunting computers and applications could become consumer-friendly devices - even a lifestyle brand. ~ Douglas Rushkoff,
199:As soon as the serpent’s body was near enough on the starboard side he jumped on to the bulwark and began hacking at it with all his might. It is true that he accomplished nothing beyond breaking Caspian’s second-best sword into bits, but it was a fine thing for a beginner to have done. ~ C S Lewis,
200:I don't see why ogling same-sex kissing should be the exclusive domain of frat boys whacking off to lesbian action, that's so sexist. Feminism should be all inclusive- it should be about sexual liberation, equal pay for equal work, and the fundamental girl right of boy2boy appreciation. ~ Rachel Cohn,
201:We've seen a departure from the traditional work of the National Security Agency. They've become sort of the national hacking agency, the national surveillance agency. And they've lost sight of the fact that everything they do is supposed to make us more secure as a nation and a society. ~ Edward Snowden,
202:The truth is, writing is this: hard and boring and occasionally great but usually not. Even I have lied about writing. I have told people that writing this book has been like brushing away dirt from a fossil. What a load of shit. It has been like hacking away at a freezer with a screwdriver. ~ Amy Poehler,
203:No matter what calamities befall him in everyday life, the true hacker still needs the pressure and inconvenience of four hours of trudging in wind or rain or sleet or sun (or all of them at once), hacking at a white pellet that seems to have a mind of its own and a lousy sense of direction. ~ Tom O Connor,
204:The truth is, writing is this: hard and boring and occasionally great but usually not. Even I have lied about writing. I have told people that writing this book has been like brushing away dirt from a fossil. What a load of shit. It has been like hacking away at a freezer with a screwdriver. I ~ Amy Poehler,
205:Part of their problem was Percy. He fought like a demon, whirling through the defender's ranks in a completely unorthodox style, rolling under their feet, slashing with his sword instead of stabbing like a Roman would, whacking campers with the flat of his blade, and generally causing mass panic. ~ Rick Riordan,
206:Aandrisks don’t have cloning laws?’ ‘No, we don’t have cloning laws.’ ‘Why?’ ‘Because we don’t do it,’ she snapped. ‘The idea never occurred to us. You know why? Because unlike you people, we think nature works fine on its own without tweaking it and hacking it and – and – oh, this is ridiculous. ~ Becky Chambers,
207:A zero-day exploit is a method of hacking a system. It's sort of a vulnerability that has an exploit written for it, sort of a key and a lock that go together to a given software package. It could be an internet web server. It could be Microsoft Office. It could be Adobe Reader or it could be Facebook. ~ Edward Snowden,
208:I've been frankly very surprised at the intensity of our differences [with Russia]. I mean, between what appears to be hacking of our political system to the aggressive use of nukes on the borders, to these atrocities in Syria and their warnings. I've been very, very surprised at the intensity of all this. ~ John Kasich,
209:I would like to say, for the record, that I am in favor of using more American Indians and other minorities in motion pictures, I am against polluting the oceans of the world, I am for every nationality having its own homeland, I am against whacking baby seals on the head, and I am for saving the whales. ~ Johnny Carson,
210:Hmm…” Melandre acknowledged the comment, then spun back, yelling at Andrake. “Quit dawdling!” She accessed her son's system and sent a flash of light across his eye-screens. “Didn’t have to do that, mum,” said Andrake as he shoved the hacking wand in his pocket and rubbed his eyes. “I was almost done. ~ Thomas K Carpenter,
211:In the words of Thoreau, “For every thousand hacking at the leaves of evil, there is one striking at the root.” We can only achieve quantum improvements in our lives as we quit hacking at the leaves of attitude and behavior and get to work on the root, the paradigms from which our attitudes and behaviors flow. ~ Stephen R Covey,
212:Both [Quine and Feyerabend] want to revise a version of positivism. Quine started with the Vienna Circle, and Feyerabend with the Copenhagen school of quantum mechanics. Both the Circle and the school have been called children of Ernst Mach; if so, the philosophies of Feyerabend and Quine must be his grandchildren. ~ Ian Hacking,
213:I think this is a scary thing [hacking] that does have to be taken out of a partisan context. And one of the best pieces of news this morning is a joint statement, Senator [Chuck] Schumer, Senator [Harry] Reid for the Democrats,John McCain and Lindsey Graham from the Republicans, saying we have to get to the bottom of this. ~ E J Dionne,
214:I wanted to stop talking about the whole thing. I wanted to talk about the hide and the old days and hacking at the ice and whose turn it was to toss the marble and all that, that was what I wanted to talk about. They were the best days, you could see through them days, as clear as polished glass. But Joe didn't want to. ~ Patrick McCabe,
215:Russia and other countries have been hacking and attempting to attack American institutions for years, that Russia's attack on American elections has been going back for over 50 years. So this is nothing new. And the fact that this particular hack was perpetrated by Russian entities is something that no one is disputing. ~ Reince Priebus,
216:I think cyber security, cyber warfare will be one of the biggest challenges facing the next president, because clearly we're facing at this point two different kinds of adversaries. There are the independent hacking groups that do it mostly for commercial reasons to try to steal information that they can use to make money. ~ Hillary Clinton,
217:It's much easier to become a hacker now. It was a private community before and you had to find your way in, like tumbling down a rabbit hole. Today, there are all-in-one desktops fully equipped with tools pre-built into the operating system, all related to hacking. They are all very powerful tools and free to download. ~ Michael Demon Calce,
218:The truth is, when bullets are whacking against tree-trunks and solid shot are cracking skulls like egg-shells, the consuming passion in the breast of the average man is to get out of the way. Between the physical fear of going forward and the moral fear of turning back, there is a predicament of exceptional awkwardness. ~ James M McPherson,
219:My mom told me once that money problems sort of sneak up on you. She said it’s like catching a cold. At first you just have a tickle in your throat, and then you have a headache, and then maybe you’re coughing a little. The next thing you know, you have a pile of Kleenexes around your bed and you’re hacking your lungs up. ~ Katherine Applegate,
220:It is hard to write a simple definition of something as varied as hacking, but I think what these activities have in common is playfulness, cleverness, and exploration. Thus, hacking means exploring the limits of what is possible, in a spirit of playful cleverness. Activities that display playful cleverness have "hack value". ~ Richard Stallman,
221:The hacking practice is quite widespread in its own right: one NSA document indicates that the agency has succeeded in infecting at least fifty thousand individual computers with a type of malware called “Quantum Insertion.” One map shows the places where such operations have been performed and the number of successful insertions: ~ Glenn Greenwald,
222:Her lack of technological sophistication is evident in her memoir, What Happened, in which she seems to intimate that her private server in Chappaqua was protected from hacking because it was contained in a home guarded by the Secret Service. Hacking a server is done through the internet, not by breaking the glass in a basement window. ~ James Comey,
223:Growth hacking становится ключевым трендом. Суть его в том, чтобы найти нестандартные подходы, чтобы «хакнуть» сам процесс развития компании, найти оригинальные пути роста, подобно тому, как хакеры взламывают коды программ. Специалисты по Growth Hacking обещают стартапам обеспечить взрывной рост количества пользователей, посещаемости и т.д. ~ Anonymous,
224:Almost overnight I switched strategy to positive reinforcement – reward good behaviour and ignore the bad. If a not-yet-house-trained puppy does his job in the garden, he gets cuddled and praised. But if he has an accident inside the house, I just clean up. No anger, no shouting, no whacking. To my astonishment, the dogs learnt very quickly. ~ Janaki Lenin,
225:Since Hillary Clinton won the popular vote, why are they complaining about the Russians hacking the election? I mean, Hillary wins the popular vote, what more can a hacker do than get you the majority of the popular vote? But yet they're running around complaining about the hackers and they're blaming the Russians for stealing the election. ~ Rush Limbaugh,
226:In the absence of big budgets, start-ups learned how to hack the system to build their companies.”2 Their hacking—which occurred right on my watch—had rethought marketing from the ground up, with none of the baggage or old assumptions. And now, their shortcuts, innovations, and backdoor solutions fly in the face of everything we’ve been taught. ~ Ryan Holiday,
227:American companies spend more than $200 billion each year hacking women's bodies into bits and pieces, urging comparisons between self and other, linking value to air-brushed ideals, and as the girls in my seventh-grade class graduated to high school and beyond, the imagery around us would only grow more specific, more pummeling, more insidious. ~ Caroline Knapp,
228:I don't think I underestimated [Vladimir Putin], but I think that I underestimated the degree to which, in this new information age, it is possible for misinformation for cyber hacking and so forth to have an impact on our open societies, our open systems, to insinuate themselves into our democratic practices in ways that I think are accelerating. ~ Barack Obama,
229:We are being at once wisely aware of our own frivolity if we avoid hitting and whacking and prefer 'striking' and 'smiting'; talk and chat and prefer 'speech' and 'discourse'; well-bred, brilliant, or polite noblemen (visions of snobbery columns in the Press, and fat men on the Riviera) and prefer the 'worthy, brave and courteous men' of long ago. ~ J R R Tolkien,
230:(Eve)"Hold on. You have to give them a gift for moving?"
"Uh-huh. Plus they're shacking, so it should be a couple thing." She (Mavis) ate another canape, fed on to Leonardo.
"Why does there have to be a gift for every damn thing?" Eve complained.
"Retail conspiracy." Roarke patter her knee.
"I bet it is," Eve said darkly. "I just bet it is. ~ J D Robb,
231:In regard to leaving, your options are
limited. Dismemberment is one, but I have a hard time imagining you hacking Cerdewellyn into
pieces, even if you had the strength. Bone is…difficult.”
She ran her hands through her hair, feeling nervous. Yeah, that’s what’s keeping me from
dismembering him, pulling a muscle as I cut through bone. ~ Caroline Hanson,
232:Movies such as 'Citizen Kane' and 'The Front Page' portrayed an era when driven newspapermen would do anything to get a story. The U.K.'s rough-and-tumble Fleet Street remains something of a throwback to that era, as demonstrated by the recent phone-hacking scandal - which led to the demise of yet another century-old paper, the 'News of the World.' ~ Nathan Myhrvold,
233:Biovirus TA TA TA targets organisms, hacking and reprogramming ATGACTTATCCACGGTACATTCAGT cellular DNA to produce more virus virus virus virus virus virus virus virus. Its enzymic cut-and-past recombinant wetware-splicing crosses singularity when retroviral reverse-transcriptase clicks in (enabling ontogenetic DNA-RNA circuitry and endocellular computation). ~ Nick Land,
234:We now self-righteously condemn the sexually abusive male. Feminist critics find a lot of hypocrisy in this stance. It allows us to conceal from ourselves that the man's behavior is only an extreme form of a more commonplace aggression toward women and children that is condoned and even encouraged, both in popular media and within the economic power structure. ~ Ian Hacking,
235:If you do away with [hacking],’ he said, ‘you will do away with all the courage and pluck of the game, and I will be bound to bring over a lot of Frenchmen who would beat you with a week’s practice.’ Sport, he appears to have felt, was about pain, brutality and manliness; without that, if it actually came down to skill, any old foreigner might be able to win. ~ Jonathan Wilson,
236:All I knew about Ireland before I went there was what I learned from watching soap commercials all my life. I was totally misinformed. I thought it was an Irish tradition where you don't even take a shower with your soap - you take your soap for a walk, you compliment the soap for a little while and then, suddenly, you just start hacking it up with a hunting knife. ~ Arj Barker,
237:We couldn't build quantum computers unless the universe were quantum and computing. We can build such machines because the universe is storing and processing information in the quantum realm. When we build quantum computers, we're hijacking that underlying computation in order to make it do things we want: little and/or/not calculations. We're hacking into the universe. ~ Seth Lloyd,
238:Readers like SapphicDerrida, who reeled off statistics and used words like “reify” in their comments, made Ifemelu nervous, eager to be fresh and to impress, so that she began, over time, to feel like a vulture hacking into the carcasses of people’s stories for something she could use. Sometimes making fragile links to race. Sometimes not believing herself. ~ Chimamanda Ngozi Adichie,
239:Sadly, as with so much about history's heroes, it's the spotting of potential fame that's the difficulty, whether it's publishing their poems, hanging their paintings, or buying their old underwear. Think of the great men whose lives passed in penury and hacking coughs due to public unawareness that their littlest possession would end up at Sothebys or the basement at Fort Knox. ~ Alan Coren,
240:Authors pretend their stories were always shiny and perfect and just waiting to be written. The truth is, writing is this: hard and boring and occasionally great but usually not. Even I have lied about writing. I have told people that writing this book has been like brushing away dirt from a fossil. What a load of shit. It has been like hacking away at a freezer with a screwdriver. ~ Amy Poehler,
241:I think Donald Trump should be delegitimized for many reasons. And his response to this hacking is also cause for delegitimization. But to say we should move on, when the bedrock of American democracy, the sanctity of our elections, has been messed with, just raises suspicions. His denial of it happening or its seriousness shows that there is something really amiss from his end of it. ~ David Corn,
242:The bad player is the one who tries to calculate and play with the odds, as if his game, his life, were one of a large number of games. To do so is at best to succumb to another necessity, the necessity of large numbers. The good player does not fool himself, and accepts that there is exactly one chance, which produces by chance the necessity and even the purpose that he experiences. ~ Ian Hacking,
243:From where you are you can hear in Cockle Row in the spring, moonless night, Miss Price, dressmaker and sweetshop-keeper, dream of her lover, tall as the town clock tower, Samson syrup-gold-maned, whacking thighed and piping hot, thunderbolt-bass'd and barnacle-breasted, flailing up the cockles with his eyes like blowlamps and scooping low over her lonely loving hotwaterbottled body. ~ Dylan Thomas,
244:"Yeah, well, you clearly also couldn't be bothered to call me and tell me you were shacking up with some dyed-blond wanna-be goth you probably met at Pandemonium. After I spent the past three days wondering if you were dead." "I was not shacking up," Clary said, glad of the darkness as the blood rushed to her face. "And my hair is naturally blond," said Jace. "Just for the record." ~ Cassandra Clare,
245:A gull planed steeply over their heads, a precarious flash of white against the windy blue sky. The short, hacking cry of a baby seemed to merge seamlessly for a moment with the gull's repetitive wail, as if they were one species. One species, Falkender thought, raucous and scavenging; one species calling out in pain. To be human is to be mixed and miscegenated like this. To be lost. ~ M John Harrison,
246:Trip? Could you do me a favor and try not to look so damn pleased with yourself?”
That made him chuckle. “I can’t help it. I’m about to bang my old girlfriend in my old room. You know how many times I jerked off right there just thinking about it? And now you’re here. And I totally get to nail your ass.”
“Yeah, um, you go anywhere near my ass and you’ll be whacking off alone again. ~ T Torrest,
247:Also, she’s shacking up with our friend,” I said. “That’s not much to go on.” “Is there an echo on this line?” I asked, my voice an octave lower. It seemed he’d recently learned the value of playing up the difficulty of accomplishing whatever he was tasked with, the better to play the hero when he subsequently pulled it off. He was overusing the technique the way a child overuses a new word. ~ Barry Eisler,
248:There are a thousand hacking at the branches of evil to one who is striking at the root, and it may be that he who bestows the largest amount of time and money on the needy is doing the most by his mode of life to produce that misery which he strives in vain to relieve. It is the pious slave-breeder devoting the proceeds of every tenth slave to buy a Sunday's liberty for the rest. Some ~ Henry David Thoreau,
249:We have to remember that at the center of all of this is the hacking, is what the Russians did during our election process, their absolute targeting our democracy. And there's President Donald Trump laughing with them. Sergey Lavrov said they did not talk about the charges against Russia. And you still hear President Trump talking as if this may not be true, others may have hacked, as well. ~ Martha Raddatz,
250:The Dictionary [Emily] Dickinson used defined tender as 'anxious for another's good' and a pioneer as 'one that goes before another to remove obstruction or to prepare the way for another.' This seems to me a good way to think of Jesus: sojourning before us, clearing the brush, bushwhacking, even---removing the impediments of sin, making a path that will lead us to our true selves, and to God. ~ Lauren F Winner,
251:The important thing is to be able to understand anyone who has something useful to say. - There is a general moral here. Be very careful and very clear about what you say. But do not be dogmatic about your own language. Be prepared to express any careful thought in the language your audience will understand. And be prepared to learn from someone who talks a language with which you are not familiar. ~ Ian Hacking,
252:WHAT DO YOU THINK YOU ARE DOING?’ ‘Oh damn,’ whispered Ginny, jumping to her feet. ‘I forgot –’ Madam Pince was swooping down on them, her shrivelled face contorted with rage. ‘Chocolate in the library!’ she screamed. ‘Out – out – OUT!’ And whipping out her wand, she caused Harry’s books, bag and ink bottle to chase him and Ginny from the library, whacking them repeatedly over the head as they ran. ~ J K Rowling,
253:It’s always wonderful to witness the emotional agility that some people with actual feelings can manage, and Vince had just performed a truly acrobatic feat, from concern for my life right to a petty problem he was having at work, all without losing a step. But beyond that, it was interesting in another way. Anderson? Hacking? “Vince, that’s not possible,” I said. “Anderson can barely work his phone. ~ Jeff Lindsay,
254:He looked so glorious. Just like the knights I had dreamed about when I was six years old, whacking at brambles iin our garden, imagining I was fighting dragons and giants with a sword that made me invincible and wearing armor that protected me from all the things that frightened me - older kids, dogs, a storm in the knight, or my little sister's questions about when our father would be coming back. ~ Cornelia Funke,
255:Most Americans are unaware that Iran’s military has such robust computer-hacking capabilities, but Mobasheri had been one of the leaders of this all-but-unheralded success of the Islamic Republic. He and his team of hackers had broken into American defense networks, and had placed infiltration-agent programs into U.S. wireless companies that had taken years and tens of millions of dollars to clean out. ~ Mark Greaney,
256:Yeah, well, you clearly also couldn’t be bothered to call me and tell me you were shacking up with some dyed-blond wanna-be goth you probably met at Pandemonium,” Simon pointed out sourly. “After I spent the past three days wondering if you were dead.” “I was not shacking up,” Clary said, glad of the darkness as the blood rushed to her face. “And my hair is naturally blond,” said Jace. “Just for the record. ~ Cassandra Clare,
257:I flung open the door. I got a momentary flash of about a hundred and fifteen cats of all sizes and colours scrapping in the middle of the room, and then they all shot past me with a rush and out of the front door; and all that was left of the mobscene was the head of a whacking big fish, lying on the carpet and staring up at me in a rather austere sort of way, as if it wanted a written explanation and apology. ~ P G Wodehouse,
258:Stories become great by hacking your brain. Nothing that happens in fiction matters. The people in fiction are fictional so their triumphs and tragedies have literally no consequence. The death of the yogurt you doomed to a fiery death in your gut acid this morning is finitely more tragic than the "deaths" of Romeo and Juliet. The yogurt was alive and then it died. Romeo and Juliet never lived in the first place. ~ Cory Doctorow,
259:Philosophers of science constantly discuss theories and representation of reality, but say almost nothing about experiment, technology, or the use of knowledge to alter the world. This is odd, because 'experimental method' used to be just another name for scientific method.... I hope [to] initiate a Back-to-Bacon movement, in which we attend more seriously to experimental science. Experimentation has a life of its own. ~ Ian Hacking,
260:The team had the hardest time hacking into the server of the J-2, the Joint Staff’s intelligence directorate. Finally, one of the team members simply called the J-2’s office and said that he was with the Pentagon’s IT department, that there were some technical problems, and that he needed to reset all the passwords. The person answering the phone gave him the existing password without hesitating. The Red Team broke in. ~ Fred Kaplan,
261:He plunged headlong into the tangle, hacking right and left with his curved blade. He saw the red-haired girl huddled in a narrow passageway between two houses. Her garments had been torn to shreds, and her flesh was raked and bruised. She was scrambling to her feet, still clutching the short dagger that had cut down a bandit. But before she could kick clear of her dead captor, another raider saw her and closed in. ~ E Hoffmann Price,
262:And every time I saw her, she seemed more beautiful. She just seemed to glow. I'm not talking like a hundred-watt bulb; she just had this warmth to her. Maybe it came from climbing that tree. Maybe it came from singing to chickens. Maybe it came from whacking at two-by-fours and dreaming about perpetual motion. I don't know. All I know is that compared to her, everybody else seemed so ordinary.
I had flipped. ~ Wendelin Van Draanen,
263:The Russian commands sound like the name of the camp commandant. Shishtvanyanov: a gnashing and spluttering collection of ch, sh, tch, shch. We can't understand the actual words, but we sense the contempt. You get used to contempt. After a while the commands just sound like a constant clearing of the throat—coughing, sneezing, nose blowing, hacking up mucus. Trudi Pelikan said: Russian is a language that's caught a cold. ~ Herta M ller,
264:The thing that has disturbed me most about the Russian hacking episode is - and the thing that surprised me most has not been the fact of Russian hacking. The cyber world is full of information gathering, you know, propaganda, et cetera. I have been concerned about the degree to which, in some circles, you've seen people suggest that Vladimir Putin has more credibility than the U.S. government. I think that's something new. ~ Barack Obama,
265:Yeah, well, you clearly also couldn't be bothered to call me and tell me you were shacking up with some dyed-blond wanna-be goth you probably met at Pandemonium. After I spent the past three days wondering if you were dead."
"I was not shacking up," Clary said, glad of the darkness as the blood rushed to her face.
"And my hair is naturally blond," said Jace. "Just for the record."
Simon, Clary, and Jace, pg. 115 ~ Cassandra Clare,
266:When there is this giant narrative, when there is a singular story out there like there is right now about the Russians hacking the election so that Donald Trump would win - when the media is pumping it and the Democrats are quoting the media and the media's quoting the Democrats and it's just like a giant blanket thrown all over the country - don't believe the story. It's made up! It is a script. I call the daily soap opera. ~ Rush Limbaugh,
267:It's a cultural disability in America that we worship pleasure, leisure, and affluence. I think the church is doubly damned when they use Jesus as a vehicle for achieving all of that. Like, if you give a tithe, He'll make you rich. Why? Are you hacking Him off or something? If you give a tithe, you get rid of ten percent of the root of all evil. You should be giving ninety percent. Cause God can handle money better than we can. ~ Rich Mullins,
268:I don't know who did the hacking [through president election 2016]. The article is based on a lie that the R.N.C. was hacked. So the entire premise of the article is false. The sources are unnamed. And the report was inconclusive.The point is, though, we need to find out more facts about this situation. Then we can make intelligent decisions later, and you and I can have more intelligent conversation about what to do about it. ~ Reince Priebus,
269:While human hacking does not occur via computer code, there are many ways to tinker with the human brain. Certainly drugs can do the tampering. How about cleverly disguised messages, disinformation, propaganda, and the newest method of tampering, fake news? Can these messages act like phishing? And what if one of these messages gains hold? Can these alter your brain? Or how about something as innocuous as food? All of the above. ~ Robert H Lustig,
270:Behind every death lay a set of questions. To move on was to agree to not disturb these questions, to let them settle with the body under the earth. Yet some questions so thoroughly dismantled the terms of your own life, turning away was gravitationally impossible. So she would not be moving on. She would keep disturbing and disturbing. She imagined herself standing over a grave with a shovel and hacking away at the soil. ~ Laura van den Berg,
271:From the open French windows Sylvie watched Maurice erecting a makeshift tennis net, which mostly seemed to involve whacking everything in sight with a mallet. Small boys were a mystery to Sylvie. The satisfaction they gained from throwing sticks or stones for hours on end, the obsessive collection of inanimate objects, the brutal destruction of the fragile world around them, all seemed at odds with the men they were supposed to become. ~ Kate Atkinson,
272:Chloe's fingers flew over her keyboard. I raised an eyebrow at Hunter. "Is she Googling hunter-assholes? I doubt they have their own Web page."
Chloe snorted. "You'd be surprised."
"She's hacking the school files," Hunter said. "She does it all the time."
"Don't they have security for that kind of thing?"
Chloe snorted again. "Please." I knew that tone. Connor used it whenever someone called his computer mojo into question. ~ Alyxandra Harvey,
273:What are the people like? Do the women wear plaid skirts, cable-knit sweaters? Are the men in hacking jackets? What’s a hacking jacket?” “They’ve grown comfortable with their money,” I said. “They genuinely believe they’re entitled to it. This conviction gives them a kind of rude health. They glow a little.” “I have trouble imagining death at that income level,” she said. “Maybe there is no death as we know it. Just documents changing hands. ~ Don DeLillo,
274:That, as far as she could tell, was the purpose of the religion she had been brought up in: it made people feel better when really horrible things happened, and it offered a repertoire of ceremonies that were used to add a touch of class to such goings-on as shacking up with someone and throwing dirt on a corpse. None of which especially bothered Zula or made her doubt its worthwhileness. Making sad people feel better was a fine thing to do. ~ Neal Stephenson,
275:Don’t you think you should lie down?” Red asked, hacking at the ham just for something to do. “Muriel says I should stay up for as long as possible. She said I’ll be so sick of lying in bed by the end that I’ll want these first few hours back.” “Hours?” Red stopped slicing and looked sideways at her. “How many hours?” “Muriel said her first child made his appearance about twenty-four hours after the first pains.” “Twenty-four hours!” Red yelled. ~ Mary Connealy,
276:I liked it.

I liked her.

And every time I saw her, she seemed more beautiful. She just seemed to glow. I'm not talking like a hundred-watt bulb; she just had this warmth to her. Maybe it came from climbing that tree. Maybe it came from singing to chickens. Maybe it came from whacking at two-by-fours and dreaming about perpetual motion. I don't know. All I know is that compared to her, Shelly and Miranda seemed so...ordinary. ~ Wendelin Van Draanen,
277:One word was floating around in stories about hackings of one sort or another: “cyber.” The word had its roots in “cybernetics,” a term dating back to the mid-nineteenth century, describing the closed loops of information systems. But in its present-day context of computer networks, the term stemmed from William Gibson’s 1984 science-fiction novel, Neuromancer, a wild and eerily prescient tale of murder and mayhem in the virtual world of “cyberspace. ~ Fred Kaplan,
278:I'm tired of my life, my clothes, the things I say. I'm hacking away at the surface, as at some kind of gray ice, trying to break through to what is underneath or I am dead. I can feel the surface trembling—it seems ready to give but it never does. I am uninterested in current events. How can I justify this? How can I explain it? I don't want to have the same vocabulary I've always had. I want something richer, broader, more penetrating and powerful. ~ James Salter,
279:The combination of GNU and Linux created an operating system that has been ported to more hardware platforms, ranging from the world’s ten biggest supercomputers to embedded systems in mobile phones, than any other operating system. “Linux is subversive,” wrote Eric Raymond. “Who would have thought that a world-class operating system could coalesce as if by magic out of part-time hacking by several thousand developers scattered all over the planet, ~ Walter Isaacson,
280:remember one of my teammates was just hacking him apart, digging something out,” one girl told me, “and I realized I was patting his arm, going, ‘It’s okay, it’s okay.’” I asked a student named Matthew whether he would miss his cadaver when the course ended, and he replied that it was actually sad when “just part of him left.” (Halfway through the course, the legs are removed and incinerated to reduce the students’ exposure to the chemical preservatives.) ~ Mary Roach,
281:For those of you unfamiliar with the term "growth hacking," growth hacking focuses exclusively on strategies and tactics (typically in digital marketing) that help grow a business or product.  The concept was first coined by Sean Ellis of Dropbox fame back in 2010 in a blog post. It has since changed the face of startup marketing, with Techcrunch guest writer Aaron Ginn explaining that a growth hacker has a "mindset of data, creativity, and curiosity. ~ Monica Leonelle,
282:I know that the body is smart, and the body is adaptable, and the body will always try to find a way, but we are smarter. We are smarter than our bodies and science has figured out a method, a clumsy method full of hacking and stitching back up, to undo biology and remake it. A messy sewing project that’s designed to circumvent nature, bypass evolution, fix everything that went wrong with your guts somewhere along the way. Because that’s the overall message. ~ Jen Larsen,
283:Master Chubb?' Malcolm asked. Halt grinned at the memory of that day. 'He's the chef at Castle Redmont. A formidable man, wouldn't you say, Horace?' Horace grinned in his turn. 'He's deadly with his wooden ladle,' he said. 'Fast and accurate. And very painful. I once suggested that he should give ladle-whacking lessons to Battleschool students.' 'You were joking, of course?' Malcolm said. Horace looked thoughtful before he replied. 'You know, not entirely. ~ John Flanagan,
284:The power of being a student is not just that it is an extended period of instruction, it also places the ego and ambition in someone else's hands. There is a sort of ego ceiling imposed-one knows that is not better than the "master" he apprentices under. Not even close. You defer to them, you subsume yourself. You cannot fake or bullshit them. An education can't be hacked; there are no shortcuts besides hacking it every single day. If you don't , they drop you. ~ Ryan Holiday,
285:[President Donald Trump ] trusts the CIA. This is about 17 or so unnamed agencies in an unnamed report that based the report on something that is totally false.The RNC was not hacked. And so the report is basically trying to make the case that the RNC was hacked, the DNC was hacked, and the only e-mails that came out were DNC e-mails, so therefore, this is the conclusive report that the Russians or whoever was doing the hacking wanted to unfairly change the election. ~ Reince Priebus,
286:Bianca swallowed past the biter chunks of broken heart clogging her throat. “I’m not going to kill him.”
From her listening post, Vivi shot her a wicked grin. “Would have been my first plan of action.”
“Whacking someone is always your first idea,” Lexie said, her laptop screen giving her green highlights an otherworldly glow.
“True.” Vivi shrugged her deceptively small shoulders, a snarky grin curling her blood-red lips. “That’s what makes me so damn charming. ~ Avery Flynn,
287:Unfortunately, the coughing drew her attention. "Are you dying or something?" she asked, affecting a perfect sneer as I shook my head. "Well, hacking up a lung out in public isn't all that attractive--just sayin'."

My face flamed, but then Benji leaned up and spoke around me. "Um, giving half the class an exhaustive summary every Monday morning--in lurid detail--of how much of an alcoholic skank you are? Isn't all that attractive either. Just sayin'. ~ Tammara Webber,
288:A retired bank vice-president named Harry Breitfeller, who lived in a comfortable duplex in Santa Monica with his wife and other relatives, stepped out on the cement porch a little after nine one morning to pick up the mail. There were half a dozen envelopes, mostly bills, in the mailbox, and a whacking big cardboard carton on the porch under it. Breitfeller picked up the carton, thinking it must be something his wife had ordered, but saw that his own name was on the label. ~ Damon Knight,
289:The strix dived at Meg. She dodged aside, whacking the flat of her blade against the bird's tail feathers as it rushed past, sending the unfortunate bird into the opposite wall, where it smacked face-first into the brick, exploding in a cloud of monster dust and feathers.
"Meg!" I said, "I told you not to kill it! You'll get cursed!"
"I didn't kill it. It committed suicide against that wall."
"I don't think the Fates will see it that way."
"Then let's not tell them. ~ Rick Riordan,
290:Mortimer had maxed three credit cards stocking the cave with canned goods and medical supplies and tools and everything a man needed to live through the end of the world. There were more than a thousand books along shelves in the driest part of the cave. There used to be several boxes of pornography until Mortimer realized that he'd spent nearly ten days in a row sitting in the cave masturbating. He burned the dirty magazines to keep from doing some terrible whacking injury to himself. ~ Victor Gischler,
291:I dump a handful of chocolate chips into the blender. Chocolate fixes everything.
Tucking the phone between my ear and shoulder, I put the lid on and flick the blender back on, sort of relishing the hacking noise the chocolate chips make as they whir.
“What the heck is that noise?” Amber asks.
“Just throwing some carrots into the blender,” I lie.
“Oh, good call! I love how carrots add that delicious bit of sweetness,” she says.
I roll my eyes. Sweetness my ass. They’re carrots. ~ Lauren Layne,
292:He laughed and was about to retort when she grabbed his collar and pulled him into her. She clamped her lips around his mouth and mashed her face into his. He took a step back in surprise and she went with him, stepping in a patch of wet floor. Her legs went out from under her and flailed as she fell, whacking him in the throat on the way down. She looked up at him as he gagged and coughed, and from across the corridor she could hear Tanith laughing hysterically. "I think I need practice," Valkyrie muttered. ~ Derek Landy,
293:It happened: the first 9/11, it happened on September 11, 1973, in Chile. We did it. Was that interfering or hacking a party? This record is all over the world, constantly overthrowing governments, invading, forcing people to follow what we call democracy, as in the cases I mentioned. As I say, if every charge is accurate, it's a joke, and I'm sure half the world is collapsing in laughter about this, because people outside the United States know it. You don't have to tell people in Chile about the first 9/11. ~ Noam Chomsky,
294:Maybe it came from whacking at two-by-fours and dreaming about perpetual motion. I don't know. All I know is that compared to her, Shelly and Miranda seemed so... ordinary.

I'd never felt like this before. Ever. And just admitting it to myself instead of hiding from it made me feel strong. Happy. I took off my shoes and socks and stuffed them in the basket. My tie whipped over my shoulder as I ran home barefoot, and realized that Garrett was right about one thing- I had flipped.

Completely. ~ Wendelin Van Draanen,
295:the police in Shanghai began carrying guns during routine patrols for the first time this week as part of a China-wide boost in police firepower following a deadly mass knifing blamed on Xinjiang separatists. Ordinary police in China generally don't carry firearms, and none of the officers patrolling the train station in the southwestern city of Kunming on March 1 was armed when at least five assailants began rapidly hacking at victims with long knives. Before armed reinforcements arrived to subdue the attack, the assailants ~ Anonymous,
296:It is said that the Queen has come to love the Commonwealth, partly because it supplies her with regular cheering crowds of flag-waving picaninnies; and one can imagine that Blair, twice victor abroad but enmired at home, is similarly seduced by foreign politeness. They say he is shortly off to the Congo. No doubt the AK47s will fall silent, and the pangas will stop their hacking of human flesh, and the tribal warriors will all break out in Watermelon smiles to see the big white chief touch down in his big white British taxpayer-funded bird. ~ Boris Johnson,
297:The report also said that there wasn't agreement among the 17 agencies. When the FBI came out - they came out - when there was a conclusion on the DNC, their conclusion was very clear and they made it public. Now, if the CIA or whoever else comes out. But they didn't conclude that it was Russia.I don't care if it's Russia or whoever, they shouldn't - we're going to protect Americans. We don't want these countries or whoever else these people are hacking our country, our parties, our - we protect our Americans. We don't like it. We're against it. ~ Reince Priebus,
298:It becomes obvious that if we want to make relatively minor changes in our lives, we can perhaps appropriately focus on our attitudes and behaviors. But if we want to make significant, quantum change, we need to work on our basic paradigms. In the words of Thoreau, “For every thousand hacking at the leaves of evil, there is one striking at the root.” We can only achieve quantum improvements in our lives as we quit hacking at the leaves of attitude and behavior and get to work on the root, the paradigms from which our attitudes and behaviors flow. ~ Stephen R Covey,
299:You can be whoever you want to be. But you will pay a price. Your parents and everyone else will punish you if you choose to be you and not them. That’s the price of your freedom. The cage is unlocked, but everyone is too scared to walk out because they whack you when you try, and they whack you hard. They want you to be scared, too. They want you to stay in the cage. But once you are a few steps beyond the trapdoor, they can’t reach you anymore, so the whacking stops. That’s another secret: They’re too afraid to follow. They adore their own cages. ~ Matthew Quick,
300:Theater of Cruelty means a theater difficult and cruel for myself first of all. And, on the level of performance, it is not the cruelty we can exercise upon each other by hacking at each other’s bodies, carving up our personal anatomies, or, like Assyrian emperors, sending parcels of human ears, noses, or neatly detached nostrils through the mail, but the much more terrible and necessary cruelty which things can exercise against us. We are not free. And the sky can still fall on our heads. And the theater has been created to teach us that first of all. ~ Antonin Artaud,
301:I support, defend, and admire prostitutes, gay or straight. They do important and necessary work, whether moralists of the Left and Right like it or not. Feminists who think they can abolish the sex trade are in a state of massive delusion. Only a ruthless, fascist regime of vast scale could eradicate the rogue sex impulse that is indistinguishable from the life force. Simply in the Western world, pagan sexuality has survived 2000 years of Judaeo-Christian persecution and is hardly going to be defeated by a few feminists whacking at it with their brooms. ~ Camille Paglia,
302:I used to listen to music from the frosting down. As a word nerd, lyrics are really important to me, and then the melody. Playing in the Rock*A*Teens was the first time I ever heard music from the bottom up. I was hearing songs I'd heard a million times on oldies radio, and I'd be like, "Wow, listen to what the bass is doing!" When I was first singing in bands, I'd just get out there with my machete, wildly whacking away at the foliage. But you learn how to listen. When I feel I'm doing it right, it's 90% listening and 10% output. It's not "look what I can do!" ~ Kelly Hogan,
303:In December 1981, the American-trained Atlacatl Battalion began its systemic execution of over 750 civilians in the Salvadoran village of El Mozote, including hundreds of children under the age of 12. The soldiers were thorough and left only one survivor. At first they stabbed and decapitated their victims, but they turned to machine guns when the hacking grew too tiresome (a decade later, an exhumation team digging through the mass graves found hundreds of bullets with head stamps indicating that the ammunition was manufactured in Lake City, Missouri, for the U.S. government). ~ Greg Grandin,
304:Poet, if you can't grow up, at least grow down. Become a carrot, a parsnip. Even a potato. Let the earth conceal your shame. You mistook the mushrooms in your head for truth. Celebrate the actual beauty of mushrooms. Rejoice in their improbabilities. Accept the shortness of the season. Accept the shortness of your own breath. If you cannot suffer light, learn to engender the dark. The poem as hacking cough, as a croaking in the larynx, as a green discharge from blackened lungs. Poet, if you propose to make poems out of your halloween existence, you must learn to shit pumpkins. ~ Robert Kroetsch,
305:So there are two reasons to embrace what happens. One is that it’s happening to you. It was prescribed for you, and it pertains to you. The thread was spun long ago, by the oldest cause of all. The other reason is that what happens to an individual is a cause of well-being in what directs the world—of its well-being, its fulfillment, of its very existence, even. Because the whole is damaged if you cut away anything—anything at all—from its continuity and its coherence. Not only its parts, but its purposes. And that’s what you’re doing when you complain: hacking and destroying. ~ Marcus Aurelius,
306:Part of their problem was Percy. He fought like a demon, whirling through the defenders’ ranks in a completely unorthodox style, rolling under their feet, slashing with his sword instead of stabbing like a Roman would, whacking campers with the flat of his blade, and generally causing mass panic. Octavian screamed in a shrill voice—maybe ordering the First Cohort to stand their ground, maybe trying to sing soprano—but Percy put a stop to it. He somersaulted over a line of shields and slammed the butt of his sword into Octavian’s helmet. The centurion collapsed like a sock puppet. Frank ~ Rick Riordan,
307:When President Nixon was reelected in a landslide in 1972, film critic Pauline Kael famously said in disbelief, “I live in a rather special world. I only know one person who voted for Nixon. Where they are I don’t know. They’re outside my ken. But sometimes when I’m in a theater I can feel them.”14 Her statement has come to symbolize the insulation of the liberal elite, living in a bubble and hearing only the opinions of fellow liberals. It has become known as “Pauline Kael Syndrome” and its most virulent strain has been discovered in late 2016, complete with paranoid delusions of Russian hacking. Liberals ~ Roger Stone,
308:... there was one new metallic monstrosity stacked in one corner that she hadn’t seen the last time she was a visitor to his strange chamber, it appeared to be a mass of hard drives all fused together, but they looked too sophisticated to be merely hard drives.
“What on earth is that?”
“That’s my Kung Fu,” he said proudly, patting the top of the futuristic-looking stack.
“Is that what you wanted to show me?”
“No, but it’s impressive, isn’t it?”
“If you say so.”
Steves sighed and shook his head, so few people could appreciate the intellectual complexity of an almost untraceable hacking device. ~ E A Bucchianeri,
309:Labels such as ‘‘the culture wars,’’ ‘‘the science wars,’’ or ‘‘the Freud wars’’ are now widely used to refer to some of the disagreements that
plague contemporary intellectual life ... But I would like to register a gentle protest. Metaphors influence the mind in many unnoticed ways. The willingness to describe fierce disagreement in terms of the metaphors of war makes the very existence of real wars seem more natural, more inevitable,
more a part of the human condition. It also betrays us into an insensibility toward the very idea of war, so that we are less prone to be aware of how totally disgusting real wars really are. ~ Ian Hacking,
310:Harshness, gruffness, and sternness are not effective in shaping a child’s will. Likewise, constant whacking and threatening and criticizing are destructive and counterproductive. A parent who is mean and angry most of the time is creating resentment that will be stored and come roaring into the relationship during adolescence or beyond. Therefore, every opportunity should be taken to keep the tenor of the home pleasant, fun, and accepting. At the same time, however, parents should display confident firmness in their demeanor. You, Mom and Dad, are the boss. You are in charge. If you believe it, the tougher child will accept it also. ~ James C Dobson,
311:George!' [Horace] said, the relief evident in his voice. 'Are you all right?'
'No! I am not!' George replied with considerable spirit. 'I have a whacking great arrow stuck through my arm and it hurts like the very dickens! How could anybody be all right in those circumstances?'...
'You saved my life, George,' Horace said gently...
George grimaced. 'Well, if I'd known it was going to hurt like this, I wouldn't have! I would have just let them shoot you! Why do you live this way?' he demanded in a high-pitched voice. 'How can you bear it? This sort of thing is very, very painful. I always suspected that warriors are crazy. Now I know. ~ John Flanagan,
312:Similarly, to be a hacker you have to get a basic thrill from solving problems, sharpening your skills, and exercising your intelligence. If you aren’t the kind of person that feels this way naturally, you’ll need to become one in order to make it as a hacker. Otherwise you’ll find your hacking energy is sapped by distractions like sex, money, and social approval. (You also have to develop a kind of faith in your own learning capacity — a belief that even though you may not know all of what you need to solve a problem, if you tackle just a piece of it and learn from that, you’ll learn enough to solve the next piece — and so on, until you’re done.) ~ Eric S Raymond,
313:QUICK MENTAL RECAP: KIDNAPPED BY Mafia gang ruled by insane, chain-smoking reject from the sixties—female; discover husband has alias name and FBI badge that he’s been able to keep hidden from me for seventeen years (reminder to self: get a clue!); follow half-baked scheme provided by Brad Pitt look-alike to make a quick getaway through guest bathroom; wind up playing bad game of Twister in bathtub with Elvis Presley wannabe; witness the whacking of FBI husband; hear Elvis Presley wannabe proclaim, regarding husband’s whacker: “That’s No Toes” and follow up with obvious comment, “Dis ain’t good.” Would Al Pacino be caught dead in this movie? Definitely not. ~ Karen Cantwell,
314:Every generation has the illusion that things were easier and better in a simpler past. Dead wrong. Things are better today than at any time in human history. Our primal ignorance is what keeps us whacking each other over the head with sticks, and not what allows us to paint a Mona Lisa or design a space shuttle. The 'primal ignorance that keeps us happy' gives rise to obesity and global warming, not antibiotics or the Magna Carta. If human kind flourishes rather than flounders over the next thousand years, it will be because we fully embraced learning and reason, and not because we surrendered to some fantasy about returning to a world that never really was. ~ Daniel Todd Gilbert,
315:An example of the extent of the FSB and GRU covert cyber collection and exploitation was the exposure of what was most likely a Russian State Security & Navy Intelligence covert operation to monitor, exploit and hack targets within the central United States from Russian merchant ships equipped with advanced hacking hardware and tools. The US Coast guard boarded the merchant ship SS Chem Hydra and in it they found wireless intercept equipment associated with Russian hacking teams. Apparently the vessel had personnel on board who were tasked to collect intelligence on wireless networks and attempt hackings on regional computer networks in the heartland of America.59 ~ Malcolm W Nance,
316:We played checkers," said Czernobog, hacking himself another lump of pot roast. "The young man and me. He won a game, I won a game. Because he won a game, I have agreed to go with him and Wednesday, and help in their madness. And because I won a game, when this is all done, I get to kill the young man, with a blow of a hammer."
The two Zoryas nodded gravely. "Such a pity," Zorya Vechernyaya told Shadow. "In my fortune for you, I should have said you would have a long life and a happy one, with many children."
"That is why you are a good fortune-teller, said Zorya Utrennyaya. She looked sleepy, as if it were effort for her to be up so late. "You tell the best lies. ~ Neil Gaiman,
317:That’s the failing of most big groups,” Scorpion said. “The big dogs give an order, and nobody underneath gets to question it, they just have to do as they’re told. Kills creativity and makes them vulnerable. That’s what I used to do when I was hacking. I’d find a big company, one that had a huge IT department. I knew that the engineers weren’t making decisions, bookkeepers were, and that meant they’d be at least two years behind on security. Those were the easy scores.” “What about government servers?” Raptor asked. “Three years behind,” Scorpion said. “But the government doesn’t have nearly as much money as a big corporation, and they aren’t trying to hide most of it. ~ John G Hartness,
318:As Chris Milk, an early VR pioneer, explains: You read a book; your brain reads letters printed in ink on paper and transforms that into a world. You watch a movie; you’re seeing imagery inside of a rectangle while you’re sitting inside a room, and your brain translates that into a world. And you connect to this even though you know it’s not real, but because you’re in the habit of suspending disbelief. With virtual reality, you’re essentially hacking the visual-audio system of your brain and feeding it a set of stimuli that’s close enough to the stimuli it expects that it sees it as truth. Instead of suspending your disbelief, you actually have to remind yourself not to believe. ~ Anonymous,
319:It's not what you're thinkin!" Jennah squawks, turning pink. "My God, you men only have one thing on the brain! We went for a walk in the park!"

"Well, we didn't exactly do very much walking," I interject, determined to wind her up.

Harry begins to laugh.

Jennah gasps in outrage. "We sat and watched the swans on the lake, thank you very much, Harry!"

Harry is still laughing. "Now could that possibly be a euphemism for--"

Jennah yelps and whacks Harry on the back of the head. Harry cries out in mock outrage. "Aargh! Is this how she treats you, Flynn? Whacking you if you don't make the bed in the morning, whacking you if you don't put the loo seat down--! ~ Tabitha Suzuma,
320:first time this week as part of a China-wide boost in police firepower following a deadly mass knifing blamed on Xinjiang separatists. Ordinary police in China generally don't carry firearms, and none of the officers patrolling the train station in the southwestern city of Kunming on March 1 was armed when at least five assailants began rapidly hacking at victims with long knives. Before armed reinforcements arrived to subdue the attack, the assailants were able to kill 29 people and wound more than 140, raising concerns about the safety of crowded public places and fears that militants from the far western region of Xinjiang may seek to strike soft targets farther east. China plans to introduce ~ Anonymous,
321:Perhaps these gigantic unsystematic "systems" of health and justice play an important part in channeling and organizing symptoms and their display. Not only do people of different sex get caught by different systems, but also the functionaries and people with little pieces of authority within these systems work on those whom they catch in order to train them to fit in with expectations. And of course once you are caught by justice or mental health, the easiest thing to do is to behave as you are supposed to-violently or weakly, as the case may be. It becomes second nature. That is a traditional suggestion of labeling theory: people adapt their natures to the labels assigned to them by authority. ~ Ian Hacking,
322:Hacking? Some programmers try to hack their way toward working code rather than using a systematic approach like the PPP. If you've ever found that you've coded yourself into a corner in a routine and have to start over, that's an indication that the PPP might work better. If you find yourself losing your train of thought in the middle of coding a routine, that's another indication that the PPP would be beneficial. Have you ever simply forgotten to write part of a class or part of routine? That hardly ever happens if you're using the PPP. If you find yourself staring at the computer screen not knowing where to start, that's a surefire sign that the PPP would make your programming life easier. ~ Steve McConnell,
323:Self knowledge is a virtue in its own right. We value the way in which people can fulfill their own natures by gaining an unsentimental self understanding. We think it is good to grow, for all our vices, into someone who is mature enough to face the past and the present, someone who understands how character, in its weaknesses as well as its strengths, is made of interlocking tendencies and gifts that have grown in the course of a life. The image of growth and maturing is Aristotelian rather than Kantian. These ancient values are ideals that none fully achieve, and yet they are modest, not seeking to find a meaning in life, but finding excellence in living and honoring life and its potentialities. ~ Ian Hacking,
324:THIS HAPPPENED, not in 312 A.D., but in August, 1971. A retired bank vice-president named Harry Breitfeller, who lived in a comfortable duplex in Santa Monica with his wife and other relatives, stepped out on the cement porch a little after nine one morning to pick up the mail. There were half a dozen envelopes, mostly bills, in the mailbox, and a whacking big cardboard carton on the porch under it. Breitfeller picked up the carton, thinking it must be something his wife had ordered, but saw that his own name was on the label. There was no return address. According to the postmark, the box had been mailed late the previous afternoon in Clear-water, which is about 34 miles northeast of Los Angeles. ~ Damon Knight,
325:Eustace (who had really been trying very hard to behave well, till the rain and the chess put him back) now did the first brave thing he had ever done. He was wearing a sword that Caspian had lent him. As soon as the serpent’s body was near enough on the starboard side he jumped on to the bulwark and began hacking at it with all his might. It is true that he accomplished nothing beyond breaking Caspian’s second-best sword into bits, but it was a fine thing for a beginner to have done.
Others would have joined him if at that moment Reepicheep had not called out, “Don’t fight! Push!” It was so unusual for the Mouse to advise anyone not to fight that, even in that terrible moment, every eye turned to him. ~ C S Lewis,
326:She glanced up with a cheerful grin. “We’ll be like a Rounders team.”
Annabelle regarded her skeptically. “You’re referring to the game in which gentlemen take turns whacking a leather ball with a flat-sided bat?”
“Not only gentlemen,” Lillian replied. “In New York, ladies may play also, as long as they don’t forget themselves in the excitement.”
Daisy smiled slyly. “Such as the time Lillian became so incensed by a bad call that she pulled a sanctuary post out of the ground.”
“It was already loose,” Lillian protested. “A loose post could have presented a danger to one of the runners.”
“Particularly while you were hurling it at them,” Daisy said, meeting her older sister’s frown with a sweet smirk. ~ Lisa Kleypas,
327:Far too often, people are woefully predictable. And I know many things. It's a curse. Here's something else I know: You are not doomed to be your parents. You can break the cycle. You can be whoever you want to be. But you will pay a price. You parents and everyone else will punish you if you choose to be you and not them. That's the price of your freedom. The cage is unlocked, but everyone is too scared to walk out because they whack you when you try, and they whack you hard. They want you to be scared, too. They want you to stay in the cage. But once you are a few steps beyond the trapdoor, they can't reach you anymore, so the whacking stops. That's another secret: They're too afraid to follow. They adore their own cages. ~ Matthew Quick,
328:With or without his senior advisers, this was the moment for Trump to make the American interest clear—namely, that the Kremlin’s hacking of the election amounted to ill-considered interference. And that any attempt by Moscow to do the same in 2018 or 2020 would lead to a stringent U.S. response—more sanctions, travel bans, even a cutoff of Russia’s access to the SWIFT banking payments system. Putin would interpret anything less than this as American weakness. And, practically, a green light for his operatives to tamper again in Washington’s affairs. All done, of course, under the same cover of plausible deniability. There was no official hacking, the government wasn’t involved, et cetera. Apparently, Trump said none of this. ~ Luke Harding,
329:It amazes me still to this day how quickly the empire fell to pieces. One day
the people are kissing the ground upon which the Tsar’s shadow has fallen, the
next they are hacking apart his body. Nikolai merely put down his scepter and
walked away, and literally overnight a three-hundred-year old dynasty
evaporated — poof, gone! — with no one lifting a finger to save it. Ironic
that the Soviet Union collapsed just as easily, which proves it was no better,
that the cure, kommunizm, was in fact far worse than the disease itself. Now,
I can only hope, those days are over, and just maybe that’s true. After all,
it took nearly one hundred years for the insanity to fade from France after
their revolution. ~ Robert Alexander,
330:I was saying, my dear, that you were clearly born under the baleful influence of Saturn,” said Professor Trelawney, a faint note of resentment in her voice at the fact that he had obviously not been hanging on her words. “Born under — what, sorry?” said Harry. “Saturn, dear, the planet Saturn!” said Professor Trelawney, sounding definitely irritated that he wasn’t riveted by this news. “I was saying that Saturn was surely in a position of power in the heavens at the moment of your birth. . . . Your dark hair . . . your mean stature . . . tragic losses so young in life . . . I think I am right in saying, my dear, that you were born in midwinter?” “No,” said Harry, “I was born in July.” Ron hastily turned his laugh into a hacking cough. ~ J K Rowling,
331:IN 1984, journalist Steven Levy published Hackers: Heroes of the Computer Revolution, which chronicled the scruffy subculture that had not only created the personal computer (and eventually the Internet) but also the unique social ethos that came with it. He listed seven principles of the “hacker ethic”: Access to computers—and anything that might teach you something about the way the world works—should be unlimited and total. Always yield to the Hands-on Imperative! All information should be free. Mistrust authority—promote decentralization. Hackers should be judged by their hacking, not bogus criteria such as degrees, age, race, or position. You can create art and beauty on a computer. Computers can change your life for the better. ~ Chris Anderson,
332:The mind is a machine that is constantly asking: What would I prefer? Close your eyes, refuse to move, and watch what your mind does. What it does is become discontent with That Which Is. A desire arises, you satisfy that desire, and another arises in its place. This wanting and rewanting is an endless cycle for which, turns out, there is already a name: samsara. Samsara is at the heart of the vast human carnival: greed, neurosis, mad ambition, adultery, crimes of passion, the hacking to death of a terrified man on a hillside in the name of A More Pure And Thus Perfect Nation--and all of this takes place because we believe we will be made happy once our desires have been satisfied.

I know this. But still I'm full of desire... --"Buddha Boy ~ George Saunders,
333:Something snapped in my mind. The noise all around me receded in a wave until all I heard was a distant, throbbing pulse like a muffled heartbeat. A legionnaire gutted one of the pirates not three strides in front of me, and the man twisted in a horrid dance as his guts spilled. He dropped his weapons—a pair of short, curved swords—and one of them landed at my feet. I picked it up. Through the red mist that drifted down before my eyes, I no longer saw a ship, or pirates. I could see only soldiers. Legionnaires in their uniforms, hacking and slashing and killing. Where the young, arrogant Decurion stood, I saw only a nameless, faceless commander of Caesar’s legions. I saw only the man who’d murdered my sister. In that moment, Caius Varro was Rome. And I . . . I was Vengeance. ~ Lesley Livingston,
334:Everyone lies about writing. They lie about how easy it is or how hard it was. They perpetuate a romantic idea that writing is some beautiful experience that takes place in an architectural room filled with leather novels and chai tea. They talk about their “morning ritual” and how they “dress for writing” and the cabin in Big Sur where they go to “be alone”—blah blah blah. No one tells the truth about writing a book. Authors pretend their stories were always shiny and perfect and just waiting to be written. The truth is, writing is this: hard and boring and occasionally great but usually not. Even I have lied about writing. I have told people that writing this book has been like brushing away dirt from a fossil. What a load of shit. It has been like hacking away at a freezer with a screwdriver. I ~ Amy Poehler,
335:We now have many statistical software packages. Their power is incredible, but the pioneers of statistical inference would have mixed feelings, for they always insisted that people think before using a routine. In the old days routines took endless hours to apply, so one had to spend a lot of time thinking in order to justify using a routine. Now one enters data and presses a button. One result is that people seem to be cowed into not asking silly questions, such as: What hypothesis are you testing? What distribution is it that you say is not normal? What population are you talking about? Where did this base rate come from? Most important of all: Whose judgments do you use to calibrate scores on your questionnaires? Are those judgments generally agreed to by the qualified experts in the entire community? ~ Ian Hacking,
336:Well... there might be a slight problem with the she-devil in your room," she admitted.

What! Demon red shimmered before his eye. "Did you harm her?"

"What? Sweet lil me? She shook her head, all innocence. "But I may or may not have done some research and come across a bit of info that said hacking off all the her hair would severely weaken her. Then I may or may not have snuck in your bedroom with a pair of scissors and taken these." She lifted her arms and clutched in both her hands were thick hanks of golden hair. "By the way, I may or may not know for a fact that the rumors are definitely not true."

Going. To. Kill. Her.

"The Red Queen may or may not have woken up mid style job," Anya continued blithely, "and may or may not have taken the scissors away from me and given me a new style of my own. ~ Gena Showalter,
337:Even back then I thought that his uncompromising judgments and unprompted opinions, which he would simply spit out undiplomatically, would put him at odds with a lot of people. There was so much to plan and discuss. I didn’t ask myself back then whether his behavior was normal or not. I didn’t ask myself whether I could trust Julian or whether he might get me in trouble. On the contrary, I was somewhat flattered that he was interested in working with me. For me, Julian Assange was not only the founder of WL but also the hacker known as Mendax, a member of the International Subversives, one of the greatest hackers in the world, and the coauthor/researcher (with Suelette Dreyfus) of Underground: Tales of Hacking, Madness and Obsession from the Electronic Frontier—a highly respected book among connoisseurs. We hit it off right from the start. He ~ Daniel Domscheit Berg,
338:By the way,” Arizona interrupted rather casually, “how long are you two gonna shack up together out there at Dreamscape?” Anger surged, temporarily submerging the little thrill of dread Hannah had felt a few seconds ago. She jerked to a halt, spun around, and glared at Arizona. “We are not shacking up.” Rafe tightened his grip on her arm. “Hannah, this isn’t the time to go into it.” “The heck it isn’t.” Hannah grabbed the edge of the door as Rafe tried to haul her forcibly out into the hall. “I want to set the record straight before we leave. Listen, Arizona, Rafe and I are sharing Dreamscape until we negotiate a way out of the mess Isabel left us in. We are not shacking up there.” “Sorta hard to tell the difference,” Arizona answered through a cloud of smoke. “Not from where I stand,” Hannah retorted. “We’re sleeping on separate floors.” “Sounds uncomfortable,” Arizona said. ~ Jayne Ann Krentz,
339:Borderline means you’re one of those girls…

…who walk around wearing long sleeves in the summer because you’ve carved up your forearms over your boyfriend. You make pathetic suicidal gestures and write bad poetry about them, listen to Ani DiFranco albums on endless repeat, end up in the emergency room for overdoses, scare off boyfriends by insisting they tell you that they love you five hundred times a day and hacking into their email to make sure they’re not lying, have a police record for shoplifting, and your tooth enamel is eroded from purging. You’ve had five addresses and eight jobs in three years, your friends are avoiding your phone calls, you’re questioning your sexuality, and the credit card companies are after you. It took a lot of years to admit that I was exactly that girl, and that the diagnostic criteria for the disorder were essentially an outline of my life. ~ Stacy Pershall,
340:And I Said To My Soul, Be Loud

Madden me back to an afternoon
I carry in me
not like a wound
but like a will against a wound

Give me again enough man
to be the child
choosing my own annihilations

To make of this severed limb
a wand to conjure
a weapon to shatter
dark matter of the dirt daubers' nests
galaxies of glass

Whacking glints
bash-dancing on the cellar's fire
I am the sound the sun would make
if the sun could make a sound

and the gasp of rot
stabbed from the compost's lumpen living death
is me

O my life my war in a jar
I shake you and shake you
and may the best ant win

For I am come a whirlwind of wasted things
and I will ride this tantrum back to God

until my fixed self, my fluorescent self
my grief–nibbling, unbewildered, wall–to–wall self
withers in me like a salted slug ~ Christian Wiman,
341:The sun was warm on my face. I knew we were safe at last.
The vast bottle of Champagne, that had sat like some Buddha at base camp for three months, was ceremoniously produced. It took four of us almost ten minutes, hacking away with ice axes, finally to get the cork out.
The party had begun.
I felt like drinking a gallon of this beautiful bubbly stuff, but my body just couldn’t. Sipping slowly was all I could manage without sneezing, and even like that I was soon feeling decidedly wobbly.
I closed my eyes and flopped against the rock wall of the mess tent--a huge smile plastered across my face.
Later on in my tent, I put on the fresh socks and thermal underwear that I had kept especially for this moment.
First change in ninety days. Heaven.
I sealed the underpants in a plastic Ziploc bag and reminded myself to be very cautious when it came to opening the bag again back home. ~ Bear Grylls,
342:A typical plague victim developed large, tumorlike buboes on the skin; they started the size of almonds and grew to the size of eggs. They were painful to the touch and brought on hideous deformities when they grew large. A bubo under the arm would force the arm to lurch uncontrollably out to the side; sited on the neck, it would force the head into a permanently cocked position. The buboes were frequently accompanied by dark blotches, known as God’s tokens, an unmistakable sign that the sufferer had been touched by the angel of death. Accompanying these violent deformities, the victim often developed a hacking cough that brought up blood and developed into incessant vomiting. He gave off a disgusting stench, which seemed to leak from every part of his body—his saliva, breath, sweat, and excrement stank overpoweringly—and eventually he began to lose his mind, wandering around screaming and collapsing in pain. ~ Dan Jones,
343:Caitlyn, s’il vous plait!” Madame said, whacking the blackboard with her stick, its end pointing to the irregular verb devoir, “to have to.” She
wanted Caitlyn to conjugate it.
Caitlyn felt the class’s attention turn to her, and a clammy sweat broke out in her armpits. Her brain stopped in its tracks, unable to move under
the pressure. A vague sense of having known how to speak French in her dreams tickled at her brain, but the skill was as lost to her in the waking
world as was Raphael.
“Devoir,” Caitlyn croaked. “Er. Je dev? Tu dev?”
Madame gaped at her, horrified.
Caitlyn shook her head; she knew those words were wrong. “Er … I mean, uh …” And then out of nowhere came, “Egli deve, lei dovrebbe …”
These words felt right. He must, she must …
Several girls burst into laughter.
“What?” Caitlyn demanded.
“You’re speaking Italian!” one girl shrieked, and collapsed into hysterical giggles. ~ Lisa Cach,
344:Rosie flicks out her second knife and takes aim. It spins out of her hand like a star, straight at the Alpha’s chest. But the Alpha knocks it away easily. He raises a clawed hand at my sister and I feel a scream erupting in my throat, recognizing the motion from seven years ago. The swing will take my sister’s eye. I storm through the still-transforming Fenris, swinging my hatchet as if I’m hacking at tree limbs. Rosie’s eyes widen in horror as the Alpha’s claws being to descend. I grit my teeth and force my body forward, now ignoring the other wolves, desperate to reach her.
A roaring scream, all human but as fierce as any Fenris howl, echoes through the parking lot. My head snaps to see its source: Silas is running toward Rosie, hunting knives in one hand, axe aloft in the other. His eyes burn brighter than any hellfire. He swings out just as the Alpha’s claws are about to reach Rosie’s face, knocking the monster out of the way. ~ Jackson Pearce,
345:I think Homer outwits most writers who have written on the War, by not taking sides. The Trojan war is not and you cannot make it be the War of Good vs. Evil. It’s just a war, a wasteful, useless, needless, stupid, protracted, cruel mess full of individual acts of courage, cowardice, nobility, betrayal, limb-hacking-off, and disembowelment. Homer was a Greek and might have been partial to the Greek side, but he had a sense of justice or balance that seems characteristically Greek—maybe his people learned a good deal of it from him? His impartiality is far from dispassionate; the story is a torrent of passionate actions, generous, despicable, magnificent, trivial. But it is unprejudiced. It isn’t Satan vs. Angels. It isn’t Holy Warriors vs. Infidels. It isn’t hobbits vs. orcs. It’s just people vs. people. Of course you can take sides, and almost everybody does. I try not to, but it’s no use, I just like the Trojans better than the Greeks. ~ Ursula K Le Guin,
346:You're all Helen talks about. She's been reading Welsh history books and plaguing the family with accounts of Owain Glynd and something called the Eistedfodd." His eyes sparkled with friendly mockery. "Helen was hacking and spitting so much the other day that we thought she was coming down with a cold, until we realized she was practicing the Welsh alphabet."
Ordinarily Rhys would have made some sarcastic retort, but he'd barely noticed the gibe. His chest had gone tight with pleasure.
"She doesn't have to do that," he muttered.
"Helen wants to please you," Devon said. "It's her nature. Which leads to something I want to make clear: Helen is like a younger sister to me. And although I'm obviously the last man alive who should lecture anyone about propriety, I expect you to behave like an altar boy with her for the next few days."
Rhys gave him a surly glance. "I *was* an altar boy, and I can tell you that reports of their virtue are highly exaggerated. ~ Lisa Kleypas,
347:Many countries have a long history of spying on foreign corporations for their own military and commercial advantage. The US claims that it does not engage in commercial espionage, meaning that it does not hack foreign corporate networks and pass that information on to US competitors for commercial advantage. But it does engage in economic espionage, by hacking into foreign corporate networks and using that information in government trade negotiations that directly benefit US corporate interests. Recent examples are the Brazilian oil company Petrobras and the European SWIFT international bank payment system. In fact, a 1996 government report boasted that the NSA claimed that the economic benefits of one of its programs to US industry “totaled tens of billions of dollars over the last several years.” You may or may not see a substantive difference between the two types of espionage. China, without so clean a separation between its government and its industries, does not. ~ Bruce Schneier,
348:And my own affairs were as bad, as dismal, as the day I had been born. The only difference was that now I could drink now and then, though never often enough. Drink was the only thing that kept a man from feeling forever stunned and useless. Everything else just kept picking and picking, hacking away. And nothing was interesting, nothing. The people were restrictive and careful, all alike. And I've got to live with these fuckers for the rest of my life, I thought. God, they all had assholes and sexual organs and their mouths and their armpits. They shit and they chattered and they were dull as horse dung. The girls looked good from a distance, the sun shining through their dresses, their hair. But get up close and listen to their minds running out of their mouths, you felt like digging in under a hill and hiding out with a tommy-gun. I would certainly never be able to be happy, to get married, I could never have children. Hell, I couldn't even get a job as a dishwasher. ~ Charles Bukowski,
349:Women, on the other hand, had to wield their intellects like a scythe, hacking away against the stubborn underbrush of low expectations. A woman who worked in the central computing pools was one step removed from the research, and the engineers’ assignments sometimes lacked the context to give the computer much knowledge about the afterlife of the numbers that bedeviled her days. She might spend weeks calculating a pressure distribution without knowing what kind of plane was being tested or whether the analysis that depended on her math had resulted in significant conclusions. The work of most of the women, like that of the Friden, Marchant, or Monroe computing machines they used, was anonymous. Even a woman who had worked closely with an engineer on the content of a research report was rarely rewarded by seeing her name alongside his on the final publication. Why would the computers have the same desire for recognition that they did? many engineers figured. They were women, after all. As ~ Margot Lee Shetterly,
350:The debate was long and furious but, after a fifth meeting at the Freemason’s Tavern in Lincoln’s Inn Fields in London, at 7:00 p.m. on December 8, 1863, carrying the ball by hand was outlawed, and soccer and rugby went their separate ways. The dispute, strangely, was not over the use of the hand but over hacking; that is, whether kicking opponents in the shins should be allowed. F. W. Campbell of Blackheath was very much in favor. “If you do away with [hacking],” he said, “you will do away with all the courage and pluck of the game, and I will be bound to bring over a lot of Frenchmen who would beat you with a week’s practice.” Sports, he appears to have believed, were about pain, brutality, and manliness; without that, if it actually came down to skill, any old foreigner might be able to win. A joke it may have been, but that his words were part of a serious debate is indicative of the general ethos, even if Blackheath did end up resigning from the association when hacking was eventually outlawed. ~ Jonathan Wilson,
351: To A Summer Poet
Yes, the Summer girl is flirting on the beach,
With a him.
And the damboy is a-climbing for the peach,
On the limb;
Yes, the bullfrog is a-croaking
And the dudelet is a-smoking
Cigarettes;
And the hackman is a-hacking
And the showman is a-cracking
Up his pets;
Yes, the Jersey 'skeeter flits along the shore
And the snapdog-we have heard it o'er and o'er;
Yes, my poet,
Well we know itKnow the spooners how they spoon
In the bright
Dollar light
Of the country tavern moon;
Yes, the caterpillars fall
From the trees (we know it all),
And with beetles all the shelves
Are alive.
Please unbuttonhole us-O,
Have the grace to let us go,
For we know
How you Summer poets thrive,
By the recapitulation
And insistent iteration
Of the wondrous doings incident to Life Among
Ourselves!
So, I pray you stop the fervor and the fuss.
For you, poor human linnet,
There's a half a living in it,
But there's not a copper cent in it for us!
~ Ambrose Bierce,
352:In my experience, the books that tend to flop upon release are those where the author goes into a cave for a year to write it, then hands it off to the publisher for release. They hope for a hit that rarely comes. On the other hand, I have clients who blog extensively before publishing. They develop their book ideas based on the themes that they naturally gravitate toward but that also get the greatest response from readers. (One client sold a book proposal using a screenshot of Google queries to his site.) They test the ideas they’re writing about in the book on their blog and when they speak in front of groups. They ask readers what they’d like to see in the book. They judge topic ideas by how many comments a given post generates, by how many Facebook “shares” an article gets. They put potential title and cover ideas up online to test and receive feedback. They look to see what hot topics other influential bloggers are riding and find ways of addressing them in their book.* The latter achieves PMF; the former never does. One is growth hacking; the other, simply guessing. ~ Ryan Holiday,
353:Dr. Joe Allen had autopsied 3,712 murder victims during his long career as the Dade County coroner, so he had seen more indescribable carnage than perhaps any other human being in the whole United States. Throughout the years Joe Allen had charted South Florida's progress by what lay dead on his steel tables, and he was long past the point of ever being shocked or nauseated. He performed meticulous surgery, kept precise files, and compiled priceless morbidity data which earned him a national reputation. For example, it was Dr. Allen who had determined that Greater Miami had more mutilation-homicides per capita than any other American city, a fact he attributed to the terrific climate. In warm weather, Allen noted, there were no outdoor elements to deter a lunatic from spending six, seven, eight hours hacking away on a victim; try that in Buffalo, and you’d freeze your ass off. After Dr. Allen had presented his findings to a big pathologists' convention, several other Sun Belt coroners had conducted their own studies and confirmed what became known as the Allen Mutilation Theorem. ~ Carl Hiaasen,
354:Hadrian walked over to where the boys were fighting and sat on the grass near Denek to watch. Denek, who was only twelve years old, glanced at him curiously. “Who are you?”

“My name is Hadrian,” he replied as he extended his hand. The boy shook it, squeezing harder than was necessary. “You’re Denek, right? The Pickerings’ third son? Perhaps you should speak with my friend Myron, seeing as how I hear you are monastery-bound.”

“Am not!” he shouted. “Going to the monastery, I mean. I can fight as well as Fanen.”

“I wouldn’t be surprised,” Hadrian said. “Fanen is flat-footed, and his balance is off. He’s not going to improve much either, because Mauvin is teaching him, and Mauvin is favoring his right and rocks back on his left too much.”

Denek grinned at Hadrian and then turned to his brothers. “Hadrian says you both fight like girls!”

“What’s that?” Mauvin said, whacking aside Fanen’s loose attack once more.

“Oh, ah, nothing,” Hadrian said, trying to recant, and glared at Denek, who just kept grinning. “Thanks a lot,” he told the boy. ~ Michael J Sullivan,
355:Everyone lies about writing. They lie about how easy it is or how hard it was. They perpetuate a romantic idea that writing is some beautiful experience that takes place in an architectural room filled with leather novels and chai tea. They talk about their “morning ritual” and how they “dress for writing” and the cabin in Big Sur where they go to “be alone”—blah blah blah. No one tells the truth about writing a book. Authors pretend their stories were always shiny and perfect and just waiting to be written. The truth is, writing is this: hard and boring and occasionally great but usually not. Even I have lied about writing. I have told people that writing this book has been like brushing away dirt from a fossil. What a load of shit. It has been like hacking away at a freezer with a screwdriver. I wrote this book after my kids went to sleep. I wrote this book on subways and on airplanes and in between setups while I shot a television show. I wrote this book from scribbled thoughts I kept in the Notes app on my iPhone and conversations I had with myself in my own head before I went to sleep. I wrote it ugly and in pieces. ~ Amy Poehler,
356: Cups Of Coffee
THE HAGGARD woman with a hacking cough and a deathless love whispers of
white
flowers ... in your poem you pour like a cup of coffee, Gabriel.
The slim girl whose voice was lost in the waves of flesh piled on her bones ... and
the woman who sold to many men and saw her breasts shrivel ... in two poems
you
pour these like a cup of coffee, Francois.
The woman whose lips are a thread of scarlet, the woman whose feet take hold
on
hell, the woman who turned to a memorial of salt looking at the lights of a
forgotten city ... in your affidavits, ancient Jews, you pour these like cups of
coffee.
The woman who took men as snakes take rabbits, a rag and a bone and a hank
of
hair, she whose eyes called men to sea dreams and shark's teeth ... in a poem
you
pour this like a cup of coffee, Kip.
Marching to the footlights in night robes with spots of blood, marching in white
sheets muffling the faces, marching with heads in the air they come back and
cough and cry and sneer:... in your poems, men, you pour these like cups of
coffee.
~ Carl Sandburg,
357:If she insists on keeping that animal, the least she can do is behave respectfully and stop shacking up with this limping has-been.”
A.J. gasped and watched as Devlin, who had been silent, closed the distance between himself and Peter. Her step-brother’s response was priceless. He looked like someone who’d stepped into the path of an avalanche.
“I’m going to do you a favor,” Devlin growled, “and forget you ever said that.” Turning to A.J. and her father, he continued with a disarming softness. “I think this argument is best left between family members. However astounding it is to witness the collective wisdom of the Sutherlands, I’d rather do something more constructive. Like watch paint dry.”
He turned and began walking away.
A.J. immediately went after him, reaching out and taking his arm. “I’m sorry he’s such a—”
Devlin carefully removed her hand. “I think you better settle this with your family first. Then we can deal with what’s going on between you and me.”
After he’d dissolved into the crowd, A.J. wheeled on her stepbrother.
“If I didn’t think he’d give you a shiner that would clash with your Day-Glo tie, I’d demand you go and apologize. ~ J R Ward,
358:Noah Kagan, a growth hacker at Facebook, the personal finance service Mint.com (which sold to Intuit for nearly $170 million), and the daily deal site AppSumo (which has more than eight hundred thousand users), explains it simply: “Marketing has always been about the same thing—who your customers are and where they are.”5 What growth hackers do is focus on the “who” and “where” more scientifically, in a more measurable way. Whereas marketing was once brand-based, with growth hacking it becomes metric and ROI driven. Suddenly, finding customers and getting attention for your product are no longer guessing games. But this is more than just marketing with better metrics; this is not just “direct marketing” with a new name. Growth hackers trace their roots back to programmers—and that’s how they see themselves. They are data scientists meets design fiends meets marketers. They welcome this information, process it and utilize it differently, and see it as desperately needed clarity in a world that has been dominated by gut instincts and artistic preference for too long. But they also add a strong acumen for strategy, for thinking big picture, and for leveraging platforms, unappreciated assets, and new ideas. ~ Ryan Holiday,
359:A diamond may be forever, but terrorism, promiscuously funded, will be too.

Let's make the connection clearly by tracing the path of the diamond. Diamonds start out in the earth, and eventually that earth is part of a country, like Sierra Leone, Angola, or the Democratic Republic of Congo. In those countries, desperate battles for control have been going on for decades, and the armies that fight the battles finance their ambitions with diamonds. Villagers are forced to mine the diamonds by ruthless rebels who maintain order through terror: by raping women and hacking off the limbs of the children, something, by the way, you never see in the De Beers ads. The rebels then smuggle the diamonds into neighboring dictatorships in exchange for guns and cash. There the diamonds are sold to the highest bidder--whether they be terrorists or "legitimate" dealers--and finally they're laundered in Europe, shipped to America, and end up in jewelry stores where they're purchased by men and given to women in exchange for oral sex.

In the feminized world we live in, it's practically national policy that women are more evolved that men--but if that's so, how come they're still so impressed by shiny objects? ~ Bill Maher,
360:But, if you've decided to go out on a limb and kill one, for goodness' sake, be prepared. We all read, with dismay, the sad story of a good woman wronged in south Mississippi who took that option and made a complete mess of the entire thing. See, first she shot him. Well, she saw right off the bat that that was a mistake because then she had this enormous dead body to deal with. He was every bit as much trouble to her dead as he ever had been alive, and was getting more so all the time. So then, she made another snap decision to cut him up in pieces and dispose of him a hunk at a time. More poor planning. First, she didn't have the proper carving utensils on hand and hacking him up proved to be just a major chore, plus it made just this colossal mess on her off-white shag living room carpet. It's getting to be like the Cat in the Hat now, only Thing Two ain't showing up to help with the clean-up. She finally gets him into portable-size portions, and wouldn't you know it? Cheap trash bags. Can anything else possible go wrong for this poor woman? So, the lesson here is obvious--for want of a small chain saw, a roll of Visqueen and some genuine Hefty bags, she is in Parchman Penitentiary today instead of New Orleans, where she'd planned to go with her new boyfriend. Preparation is everything. ~ Jill Conner Browne,
361:Another time we were at work in a trench. The dawn was grey around us; grey was the sky above; grey the snow in the pale light of dawn; grey the rags in which my fellow prisoners were clad, and grey ther faces. I was again conversing silently with my wife, or perhaps I was struggling to find the reason for my sufferings, my slow dying. In a last violent protest against the hopelessness of imminent death, I sensed my spirit piercing through the enveloping gloom. I felt it transcend that hopeless, meaningless world, and from somewhere I heard a victorious 'Yes' in answer to my question of the existence of an ultimate purpose. At that moment a light was lit in a distant farmhouse, which stood on the horizon as if painted there, in the midst of the miserable grey of dawning morning in Bavaria. 'Et lux in tenebris lucet' - and the light shineth in the darkness. For hours I stood hacking at the icy ground. The guard passed by, insulting me, and once again I communed with my beloved. More and more I felt that she was present, that she was with me; I had the feeling that I was able to touch her, able to stretch out my hand and grasp hers. The feeling was very strong: she was there. Then, at that very moment, a bird flew down silently and perched just in front of me, on the heap of soil which I had dug up from the ditch, and looked steadily at me. ~ Viktor E Frankl,
362:Brainhacking works. By following a few simple instructions, you can, over time, change the nature of your brain to make it more resilient, more resistant to aging, and more capable of happiness, compassion, and clarity. The data is in, and it matters. It matters, in fact, in two distinct ways. First, as this hard data filters through the U.S. healthcare industry, the educational system, the military, and the corporate world, to name just a few examples, it will become clear that mindfulness is among the most cost-effective methods ever for reducing hospital stays, advancing educational opportunity, and improving the functioning of organizations. This will be a game-changer. Second, the science changes how the dharma is even to be understood. This hard data is the opposite of soft spirituality. Meditation and mindfulness are tools, not a set of spiritual exercises whose merit depends on faith or some unknown forces. This is why I’ve used the word “technology” in describing the work of meditation, why Kenneth Folk calls it a form of “contemplative fitness,” and why I like the term “brainhacking.” We’re not referring here to actual, physical technologies like electrodes or vibrating implants or special sounds that put you into an altered state (although all of these exist). Rather, when I say “technology,” I’m thinking of how meditation and mindfulness are tools—processes that lead to predictable results. ~ Jay Michaelson,
363:Much. so there is free dessert involved here." I put my hand to my forehead. "oh, that i had discovered the job first!"
Ryan laughs. "tragic."
want to hear something tragic? my dad is going to a Christian singles' retreat."
Ryan nearly spits out his coffee. "your dad?" he is shacking.
Brandon wallops him on the back a few times. Ryan holds his hands up at him, coughing. "Stop," he croaks, standing. he inhales a few times and gets his voice back. "You would have to tell me this when my mouth was full, wouldn't you?" he sits again.
I smile broadly.
a Christian singles' retreat?" he repeats
Yep," Brandon says. "Get the name: Marley's Michigan Marriage Makers."
I cover my face
Ryan's expression twists. " thats.... interesting," he says slowly
Hallie frowns. "If its a Christian retreat, why is it called Marley's?"
Its a denomination in Michigan," Brandon says. "Marlotist. I just call them Marley for fun."
I double over until my head hits the table.
There is not a denomination called Marlotist," Hallie says.
Is too. I visited one of their churches when I went to Michigan to ski one time," Brandon says.
My eyes blur with tears from laughing so hard and holding it all in. My shoulders start shaking.
Brandon levels a good kick to my shin.
Ow!" I reach for my leg.
What is the name of it, Laurie?" Ryan asks.
Meet Your Match in Michigan"
Brandon scowls at me. " Spoilsport. ~ Erynn Mangum,
364:Woven deep into the vast communication networks wrapping the globe, we also find evidence of embryonic technological autonomy. The technium contains 170 quadrillion computer chips wired up into one mega-scale computing platform. The total number of transistors in this global network is now approximately the same as the number of neurons in your brain. And the number of links among files in this network (think of all the links among all the web pages of the world) is about equal to the number of synapse links in your brain. Thus, this growing planetary electronic membrane is already comparable to the complexity of a human brain. It has three billion artificial eyes (phone and webcams) plugged in, it processes keyword searches at the humming rate of 14 kilohertz (a barely audible high-pitched whine), and it is so large a contraption that it now consumes 5 percent of the world’s electricity. When computer scientists dissect the massive rivers of traffic flowing through it, they cannot account for the source of all the bits. Every now and then a bit is transmitted incorrectly, and while most of those mutations can be attributed to identifiable causes such as hacking, machine error, or line damage, the researchers are left with a few percent that somehow changed themselves. In other words, a small fraction of what the technium communicates originates not from any of its known human-made nodes but from the system at large. The technium is whispering to itself. ~ Kevin Kelly,
365:Hold on to me!” Tedros yelled, hacking briars with his training sword.Dazed, Agatha clung to his chest as he withstood thorn lashes with moans of pain. Soon he had the upper hand and pulled Agatha from the Woods towards the spiked gates, which glowed in recognition and pulled apart, cleaving a narrow path for the two Evers. As the gates speared shut behind them,Agatha looked up at limping Tedros, crisscrossed with bloody scratches, blue shirt shredded away.
“Had a feeling Sophie was getting in through the Woods,” he panted, hauling her up into slashed arms before she could protest. “So Professor Dovey gave me permission to take some fairies and stakeout the outer gates. Should have known you’d be here trying to catch her yourself.”
Agatha gaped at him dumbly.
“Stupid idea for a princess to take on witches alone,” Tedros said, dripping sweat on her pink dress.
“Where is she?” Agatha croaked. “Is she safe?”
“Not a good idea for princesses to worry about witches either,” Tedros said, hands gripping her waist. Her stomach exploded with butterflies.
“Put me down,” she sputtered—
“More bad ideas from the princess.”
“Put me down!”Tedros obeyed and Agatha pulled away.
“I’m not a princess!” she snapped, fixing her collar.
“If you say so,” the prince said, eyes drifting downward.Agatha followed them to her gashed legs, waterfalls of brilliant blood. She saw blood blurring— Tedros smiled.
“One . . . two . . . three . . .”She fainted in his arms.
“Definitely a princess,” he said. ~ Soman Chainani,
366:Imagine…

There’s a roast goose in Hong Kong—Mongkok, near the outskirts of the city, the place looks like any other. But you sink your teeth into the quickly hacked pieces and you know you’re experiencing something special. Layers of what can only be described as enlightenment, one extraordinary sensation after another as the popils of the tongue encounter first the crispy, caramelized skin, then air, then fat—the juicy, sweet yet savory, ever so slightly gamey meat, the fat just barely managing to retain its corporeal form before quickly dematerializing into liquid. These are the kinds of tastes and textures that come with year after year of the same man making the same dish. That man—the one there, behind the counter with the cleaver—hacking roast pork, and roast duck, and roast goose as he’s done since he was a child and as his father did before him. He’s got it right now for sure—and, sitting there at one of the white Formica tables, Cantonese pop songs oozing and occasionally distorting from an undersized speaker, you know it, too. In fact, you’re pretty goddamn sure this is the best roast goose on the whole planet. Nobody is eating goose better than you at this precise moment. Maybe in the whole history of the world there has never been a better goose. Ordinarily, you don’t know if you’d go that far describing a dish—but now, with that ethereal goose fat dribbling down your chin, the sound of perfectly crackling skin playing inside your head to an audience of one, hyperbole seems entirely appropriate. ~ Anthony Bourdain,
367:MAYBE IT WOULD be a good idea to rearrange the flat a bit,’ said Mum. ‘I’ve been thinking. You and Kendall might like your own den, more of a play space. So how about us turning the bedroom into your room. It’s purple too, your favourite colour.’ ‘Lilac isn’t purple.’ ‘It’s light purple, Miss Picky. Anyway, I was thinking of getting a little portable telly for you two. You’d like that, wouldn’t you? Then the living room could be more – well, my room.’ ‘And you want to put a socking great bed in it for you and Jake,’ I said coldly. ‘No I don’t! Well. I was thinking about one of them sofa beds. Then if Jake should want to stay over . . .’ ‘Why can’t he stay in his own place?’ ‘He hasn’t exactly got his own place,’ said Mum. ‘He’s staying with a friend at the moment.’ ‘Why can’t he get his own place, then?’ I said. ‘Because he hasn’t got any money. He’s a student.’ ‘They give them rooms in the university, don’t they?’ ‘Only the first year. For God’s sake, Lola Rose, give it a rest. He’s coming to live with us and that’s that. I don’t see why you’ve got such a problem with it. We’re in love, can’t you see?’ ‘He doesn’t love you. He’s just shacking up with us because he hasn’t got anywhere else. And you spend a fortune on him. Our fortune.’ Mum slapped me straight across the face. Kendall was watching. He cried. I didn’t cry. I stared Mum out. ‘You only slapped me because you know it’s true.’ ‘I slapped you because you’re a spoilt little cow,’ Mum snapped. ‘What’s the matter with you, Lola Rose? You can’t be jealous, can you? ~ Jacqueline Wilson,
368:Yeah, let’s get John here. That way we can stall for a while longer. We can keep on doing nothing for just a little while longer.”
Albert said, “Take it easy, Howard.”
“Take it easy?” Howard jumped to his feet. “Yeah? Where were you last night, Albert? Huh? Because I didn’t see you out there on the street listening to kids screaming, seeing kids running around hurt and scared and choking, and Edilio and Orc struggling, and Dekka hacking up her lungs and Jack crying and…
“You know who couldn’t even take it?” Howard raged. “You know who couldn’t even take what was happening? Orc. Orc, who’s not scared of anything. Orc, who everyone thinks is some kind of monster. He couldn’t take it. He couldn’t…but he did. And where were you, Albert? Counting your money? How about you, Astrid? Praying to Jesus?”
Astrid’s throat tightened. She couldn’t breathe. For a moment panic threatened to overwhelm her. She wanted to run from the room, run away and never look back.
Edilio got to his feet and put an arm around Howard. Howard allowed it, and then he did something Astrid never thought she would see. Howard buried his face in Edilio’s shoulder and cried, racking sobs.
“We’re falling apart,” Astrid whispered for herself alone.
But there was no easy escape. Everything Howard had said was true. She could see the truth reflected in Albert’s stunned expression. The two of them, the smart ones, the clever ones, the great defenders of truth and fairness and justice, had done nothing while others had worked themselves to exhaustion. ~ Michael Grant,
369:and at one point they had heard what had sounded mighty like a musket shot which, although not very near, might or might not have been fired in their direction but, they decided, probably had been. Harry clung to this adventure, such as it was, all the more tenaciously when he found that because of his sprained wrist he had missed an adventure at Captainganj. Those of his peers who had escaped with life and limb from the Captainganj parade ground did not seem to be thinking of it as an adventure, those who had managed to escape unhurt were now looking tired and shocked. And they seemed to be having trouble telling Harry what it had been like. Each of them simply had two or three terrible scenes printed on his mind: an Englishwoman trying to say something to him with her throat cut, or a comrade spinning down into a whirl-pool of hacking sepoys, something of that sort. To make things worse, one kept finding oneself about to say something to a friend who was not there to hear it any more. It was hard to make any sense out of what had happened, and after a while they gave up trying. Of the score of subalterns who had managed to escape, the majority had never seen a dead person before . . . a dead English person, anyway . . . one occasionally bumped into a dead native here and there but that was not quite the same. Strangely enough, they listened quite enviously to Harry talking about the musket shot which had “almost definitely” been fired at himself and Fleury. They wished they had had an adventure too, instead of their involuntary glimpse of the abattoir. It ~ J G Farrell,
370:But she was barely listening. “There’s this newish thing from Amazon? Called an AMI—an Amazon Machine Image. Basically it runs a snapshot of an operating system. There are hundreds of them, loaded up and ready to run.” Evan said, “Um.” “Virtual machines,” she explained, with a not-insubstantial trace of irritation. “Okay.” “But the good thing with virtual machines? You hit a button and you have two of them. Or ten thousand. In data centers all over the world. Here—look—I’m replicating them now, requesting that they’re geographically dispersed with guaranteed availability.” He looked but could not keep up with the speed at which things were happening on the screen. Despite his well-above-average hacking skills, he felt like a beginning skier atop a black-diamond run. She was still talking. “We upload all the encrypted data from the laptop to the cloud first, right? Like you were explaining poorly and condescendingly to me back at the motel.” “In hindsight—” “And we spread the job out among all of them. Get Hashkiller whaling away, throwing all these password combinations at it. Then who cares if we get locked out after three wrong password attempts? We just go to the next virtual machine. And the one after that.” “How do you have the hardware to handle all that?” She finally paused, blowing a glossy curl out of her eyes. “That’s what I’m telling you, X. You don’t buy hardware anymore. You rent cycles in the cloud. And the second we’re done, we kill the virtual machines and there’s not a single trace of what we did.” She lifted her hands like a low-rent spiritual guru. “It’s all around and nowhere at the same time.” A sly grin. “Like you. ~ Gregg Hurwitz,
371:Then Sister Loretta got to her point. “There are some boys in here who probably play with themselves at night. Abuse themselves. I am sure all of you know what I mean.” “Yes, Sister,” Ben thought, hating her, “I know what you mean.” “Always remember that your bodies are temples of the Holy Ghost and when you abuse yourself sexually, you are also abusing the house of God. Scientists call this vile habit masturbation, but it is more aptly referred to as self-abuse,” she said, glaring into the collective face of adolescence which suffered before her. “Self-abuse,” she repeated. “Just think of these two words and you will never be tempted to engage in this again. God knows if you abuse yourself. He watches you. He sees you do it. It disgusts him. It disgusts him so much that he calls his mother, the Blessed Virgin, to his side to watch the hideous spectacle. Then he calls his angels to watch and all the Saints in heaven. Thousands upon thousands of Saints and Angels are watching you every hour of the day. They especially watch you when you are alone at night. They see the dirty things you do with your hands and private parts. All of heaven: God, Jesus, the Holy Ghost, the Blessed Mother, the Seraphim, and all the other Angels scream out their hatred of you, chant and sing that they despise you as they watch you flaunt yourself and weaken yourself with your filthy acts.” As Ben listened in pitched horror at Sister Loretta’s portraiture of heaven’s entire populace jeering at some thin lad’s whacking off in the privacy of his room, not knowing he was being observed by the entire celestial civilization, Ben thought of himself, his sinfulness, and his innocence. He had received no preparation—none—for his entry into the arena of a Catholic adolescence ~ Pat Conroy,
372:Adrian looked over at me again. “Who knows more about male weakness: you or me?”

“Go on.” I refused to directly answer the question.

“Get a new dress. One that shows a lot of skin. Short. Strapless. Maybe a push-up bra too.” He actually had the audacity to do a quick assessment of my chest. “Eh, maybe not. But definitely some high heels.”

“Adrian,” I exclaimed. “You’ve seen how Alchemists dress. Do you think I can really wear something like that?”

He was unconcerned. “You’ll make it work. You’ll change clothes or something. But I’m telling you, if you want to get a guy to do something that might be difficult, then the best way is to distract him so that he can’t devote his full brainpower to the consequences.”

“You don’t have a lot of faith in your own gender.”

“Hey, I’m telling you the truth. I’ve been distracted by sexy dresses a lot.”

I didn’t really know if that was a valid argument, seeing as Adrian was distracted by a lot of things. Fondue. T-shirts. Kittens. “And so, what then? I show some skin, and the world is mine?”

“That’ll help.” Amazingly, I could tell he was dead serious. “And you’ve gotta act confident the whole time, like it’s already a done deal. Then make sure when you’re actually asking for what you want that you tell him you’d be ‘so, so grateful.’ But don’t elaborate. His imagination will do half the work for you. ”

I shook my head, glad we’d almost reached our destination. I didn’t know how much more I could listen to. “This is the most ridiculous advice I’ve ever heard. It’s also kind of sexist too, but I can’t decide who it offends more, men or women.”

“Look, Sage. I don’t know much about chemistry or computer hacking or photosynthery, but this is something I’ve got a lot of experience with.” I think he meant photosynthesis, but I didn’t correct him. “Use my knowledge. Don’t let it go to waste. ~ Richelle Mead,
373:Eventually, seven independent inquiries exonerated the climate scientists, finding nothing in the e-mails to discredit their work or the larger consensus on global warming. In the meantime, though, Michael Mann’s life, along with the environmental movement, was plunged into turmoil. Mann was among the scientists most roiled by the mysterious hacking incident. Four words in the purloined e-mails were seized upon as evidence that he was a fraud. In describing his research, his colleagues had praised his use of a “trick” that had helped him “hide the decline.” Mann’s detractors leaped to the conclusion that these words proved that his research was just a “trick” to fool the public and that he had deliberately hidden an actual “decline” in twentieth-century temperatures in order to fake evidence of global warming. The facts, when fully understood, were very different. It was a British colleague, not Mann, who had written the ostensibly damning words, and when examined in context, they were utterly mundane. The “trick” referred to was just a clever technique Mann had devised in order to provide a backup data set. The “decline” in question was a reference to a decline in available information from certain kinds of tree rings after 1961, which had made it hard to have a consistent set of data. Another scientist, not Mann, had found an alternative source of data to compensate for this problem, which was what was meant by “hide the decline.” The only genuinely negative disclosure from the e-mails was that Mann and the other climatologists had agreed among themselves to withhold, rather than share, their research with some of their critics, whom they disparaged. Given the harassment they had been subjected to, their reasoning was understandable, but it violated the customary transparency expected within the scientific community. Other than that, the “Climategate” scandal was, in other words, not one. ~ Jane Mayer,
374:Then Israel Finch got to his feet and pointed the light at Dolly. He told Tommy to hold her arms, and Tommy roared as if they were the funniest words in his reduced language. Realizing his cut wasn’t mortal, Israel slapped Dolly across the mouth, told her she was in for deep regret now, boy, and reaching forth his strong smelly hands rent open the front of her sweater. That, Dolly said, is when she would’ve started to give up inside, had she not looked over Israel’s shoulder and seen Dad coming. Keep in mind he ought not’ve been visible at all; there were no lights on but the flashlight, which was aimed at Dolly. She said Dad’s face coming toward them was luminous of itself, glowing and serene, the way you’d suppose an angel’s would be, that it rose up behind Israel Finch like a sudden moon, and when Tommy Basca saw it he was so startled he dropped her right down on her bottom. She said Dad was as silent, those next moments, as he was incandescent; he made no sound except a strange whistling, which turned out, of course, to be the broom handle, en route to any number of painful destinations. What was odd, she said, was how the boys weren’t even up to the job of running away—Tommy went screeching to his knees before the first blow landed, and Israel prostrated himself and moaned as though the devil had hold of his liver. The two of them just lost their minds, Dolly said, while her own reaction was nearly as insensible; she suddenly could not stop laughing. Here was Dad, his face still lit though now even the flashlight had gone out, smiling (Dolly said) though his eyes looked terribly melancholy, whacking Finch and Basca every second or two while the pair of them shrieked in no English you’d recognize—Dolly said the laughter just flooded through her and came not only from relief, as you might surmise, but from a reckless and holy sort of joy she had never felt before, not even while cheerleading. ~ Leif Enger,
375:Generally, a mood will run its course in an inteligent man; if a woman doesn't puncture it prematurely, the man will puncture it himself. He will regain his senses somewhere along the way; he will say, "Now wait, we had better think about this." That is, if his wife hasn't said five minutes before, "Now, dear, don't you think we had better think about this?" Because then he won't, of course.

If a woman is needling, it is doubly hard for a man to come out of a mood. That intensifies it. A man is really in a kind of travail when he is in a mood. He needs help, not needling, but feminine help. He probably won't thank you for it, but inside he will be awfully grateful.

When a woman has to deal with a man in a mood, she generally does the wrong thing. She generally gets her animus out, that nasty thing, and says, "Now, look, this is utter nonsense, stop it. We don't need any more fishline leader."

That is just throwing gasoline on the fire. There will be an anima-animus exchange, and all will be lost. The two are in the right hand and in the left hand of the goddess Maya, and you might as well give up for the afternoon.

There is, however, a point of genius that a woman can bring forth if she is capable of it and willing to do it. If she will become more feminine than the mood attacking the man , she can dispel it for him. But this is a very, very difficult thing for a woman to do. Her automatic response is to let out the sword of the animus and start hacking away. But if a woman can be patient with a man and not critical, but represent for him a true feminine quality, then, as soon as his sanity is sufficiently back for him to comprehend such subtleties, he will likely come out of his mood.

A wife can help a great deal if she will function from her feminine side in this way. She has to have a mature feminity to do this, a femininity that is strong enough to stand in the face of this spurious femininity the man is producing. ~ Robert A Johnson,
376:Theseus Within the Labyrinth pt.1

The lives of Greeks in the old days were deep,
mysterious and often lead to questions like
just what was wrong with Ariadne anyway, that’s
what I’d like to know? She would have done
anything for that rascally Theseus, and what
did he do but sneak out in the night and row
back to his ship with black sails. Let’s get
the heck out of here, he muttered to his crew
and they leaned on their oars as he went whack-
whack on the whacking board—a human metronome
of adventure and ill-fortune. She was King Minos’s
daughter and had helped Theseus kill the king’s
pet monster, her half-brother, so possibly
he didn’t like feeling beholden—people might
think he wasn’t tough. But certainly he’d spent
his life knocking chips off shoulders and flattening
any fellow reckless enough to step across a line
drawn in the dust. If you wanted a punch thrown,
Theseus was just the cowboy to throw it. I’m only
happy when hitting and scratching, he’d told Ariadne
that first night. So he’d been the logical choice
to sail down from Athens to Crete to stop this
nonsense of a tribute of virgins for some
monster to eat. Those Cretans called it eating but
Theseus thought himself no fool and liked a virgin
as well as the next man. Not that he could have got
into the Labyrinth without Ariadne’s help or out
either for that matter. As for the Minotaur, lounging
on his couch, nibbling grapes and sipping wine, while
a troop of ex-virgins fluttered to his beck and call,
Theseus must have scared the horns right off him,
slamming back the door and standing there in his lion
skin suit and waving that ugly club. The poor beast
might have had a stroke had there been time before
Theseus pummelled him into the earth. Then, with
Ariadne’s help, Theseus escaped, and soon after he
ditched her on an island and sailed off in his ship
with black sails, which returns us to the question:
Just what was wrong with Ariadne anyway? ~ Stephen Dobyns,
377:Lagos, typically for a nonbusinessman, had a fatal flaw: he thought too small.
He figured that with a little venture capital, this neurolinguistic hacking
could be developed as a new technology that would enable Rife to maintain
possession of information that had passed into the brains of his programmers.
Which, moral considerations aside, wasn't a bad idea.
"Rife likes to think big. He immediately saw that this idea could be much more
powerful. He took Lagos's idea and told Lagos himself to buzz off. Then he
started dumping a lot of money into Pentecostal churches. He took a small
church in Bayview, Texas, and built it up into a university. He took a smalltime
preacher, the Reverend Wayne Bedford, and made him more important than the
Pope. He constructed a string of self-supporting religious franchises all over
the world, and used his university, and its Metaverse campus, to crank out tens
of thousands of missionaries, who fanned out all over the Third World and began
converting people by the hundreds of thousands, just like St. Louis Bertrand.
L. Bob Rife's glossolalia cult is the most successful religion since the
creation of Islam. They do a lot of talking about Jesus, but like many selfdescribed
Christian churches, it has nothing to do with Christianity except that
they use his name. It's a postrational religion.
"He also wanted to spread the biological virus as a promoter or enhancer of the
cult, but he couldn't really get away with doing that through the use of cult
prostitution because it is flagrantly anti-Christian. But one of the major
functions of his Third World missionaries was to go out into the hinterlands and
vaccinate people -- and there was more than just vaccine in those needles.
"Here in the First World, everyone has already been vaccinated, and we don't let
religious fanatics come up and poke needles into us. But we do take a lot of
drugs. So for us, he devised a means for extracting the virus from human blood
serum and packaged it as a drug known as Snow Crash. ~ Neal Stephenson,
378:Isn't there something in Genesis about not looking back? A stupid glance over my shoulder showed her expression relaxing, glad I wasn't taking anything that couldn't be replaced and glad I didn't destroy anything that couldn't be repaired. "Do you care for me, Georgia?" I asked her. "Tell me you don't and I'm out of your life forever." She stood in the driveway with her arms wrapped around herself like she was freezing. "Andre is on his way."
"I didn't ask you about no Andre."
"He'll be here in a minute."
My head hurt, but I pressed her. "It's a yes-or-no question."
"Can we talk when Andre gets back? We can-"
"Stop talking about him. I want to know if you love me."
"Andre…"
She said his name one time too many. For what happened next, she would have to take some of the blame. I asked her a simple question and she refused to give me a simple answer. I turned from her and made a sharp left turn, pounding across the yard, feeling the dry grass crunch under my shoes. Six long strides put me at the base of the massive tree. I touched the rough bark, an instant of reflection, to give Old Hickey the benefit of the doubt. But in reality, a hickory tree was a useless hunk of wood. Tall, and that's all. To break the shell of a hickory nut, you needed a hammer and an act of Congress, and even then you needed a screwdriver to get at the meat, which was about as tasty as a clod of limestone. Nobody would ever mourn a hickory tree except Celestial, and maybe Andre. When I was a boy, so little I couldn't manage much more than a George Washington hatcher, Big Roy taught me how to take down a tree. Bend your knees, swing hard and low, follow up with a straight chop. Celestial was crying like the baby we never had, yelping and mewing with every swing. Believe me when I say that I didn't slow my pace, even though my shoulders burned and my arms strained and quivered. With every blow, wedges of fresh wood flew from the wounded trunk peppering my face with hot bites. "Speak up, Georgia," I shouted, hacking at the thick grey bark, experiencing pleasure and power with each stroke. "I asked you if you loved me. ~ Tayari Jones,
379:He fakes a smile and then turns to unlock the door.
I follow him inside; he stops me at the kitchen island. “I found it right here.” He points to the countertop.
“You found what right where?” I ask, feeling my face scrunch up in bewilderment.
“The crossword puzzle from today.” He pulls it out of his pocket. “I found it here when I was making breakfast this morning.”
“Wait, you didn’t get it in the mail?”
“I’m sorry; I thought I mentioned that.”
“No,” I say, holding back from whacking him in the head. “I think I would’ve remembered if someone had broken into your apartment.
“I’m sorry,” he repeats, and then lets out a stress-filled sigh.
“So, someone broke in here last night while you were asleep?”
“I’m not sure. I was thinking that, too, but then . . . what if I just didn’t see it last night when I got home?”
“Are you sure you didn’t set your mail down here, maybe even for a second, and then leave this piece behind?”
“What difference does it makes?”
“It makes a huge difference.” My voice gets louder. “The difference between someone breaking in or not.” I peer around the kitchen and living room, trying to see if anything looks off.
“I don’t know.” He reaches for a box of cereal. “I mean, I’m pretty sure I would’ve noticed getting another puzzle in the mail, especially since we’ve been talking so much about this stuff.”
“Who has a key to your apartment?”
“No one that I know of.”
“None of your friends? Did you leave a spare under the doormat, maybe?”
“No, and no.”
“Then what?” I ask, completely frustrated.
“Look,” he says, running his fingers through his shaggy brown hair. “I don’t have all the answers. That’s why it’s a puzzle.”
“This isn’t funny,” I tell him. “Someone’s sending you threatening notes, writing twisted messages on your door, and possibly breaking into your apartment. Worrying isn’t an option. It’s an order.”
“So what do you order me to do?”
“Call the police.”
“And tell them what? That someone’s sending me crossword puzzles? That I got an angry message on my door, but I didn’t even feel the need to save it? They’ll give me a Breathalyzer test and ask me what I’ve been drinking. ~ Laurie Faria Stolarz,
380:You about ready for some input?” Noah asked. “It’s free advice, and you’re under no obligation.” “Go for it,” Sean said. “Forget all that—it’s in the past. You’ll work through it, hopefully without hurting each other. Right now? Get to know your daughter. It’s the most important part of this whole drama. Get to know Rosie. Whether you want to be a father or not, you are one, so press on—start a relationship with her right away. Both of you have been missing out.” “How’m I gonna do that?!” “Show up. Talk to her. Play with her. I let Ellie’s daughter put ribbons and clips and stuff in my hair. It’s a bonding experience for us both—I get to look stupid and she gets control.” “What if she asks…?” “Tell her before she asks,” Noah advised. “If you know for sure you’re her father, you better tell her the second you meet her. There’s a period of adjustment for both of you. Get started on it. All that stuff that went before? That separated you from Franci? You don’t have to work on that with Rosie. You and Franci will work that out. I’m available if you need me. I can help with that.” Sean just stared at him for a long moment, silent. Finally he asked, “Do you really know what you’re doing here?” “I do,” Noah said. “I actually studied and practiced counseling before the seminary. I have a degree and everything.” “What am I going to tell Luke?” “Everything or nothing,” Noah said. “The most important thing right now is not what you tell other people, it’s what you tell Rosie. She’s a little girl. Whether she knows it or not, she wants a father. She needs a father. You’re that person. Good luck—you’re going to have to learn fast to fully understand what that means.” “The next person who needs to know about this has to be my mother. In case you haven’t noticed, my mother is a very strong woman with very firm ideas.” “I’m not as good with mothers,” Noah admitted. “You’ll be fine. I bet she loves you.” Sean shook his head. “It never kept her from whacking me in the back of the head if I didn’t do what she liked. Strict. My mother was strict. All five of us were altar boys. She’s wanted grandchildren for a long, long time. The fact that she’s had one for this long without knowing? Oh, man, I’m never going to hear the end of that.” Noah chuckled. “Just duck,” he advised. * ~ Robyn Carr,
381:Yet change is usually stressful, and after a certain age, most people don’t like to change. When you are 16, your entire life is change, whether you like it or not. Your body is changing, your mind is changing, your relationships are changing—everything is in flux. You are busy inventing yourself. By the time you are 40, you don’t want change. You want stability. But in the twenty-first century, you won’t be able to enjoy that luxury. If you try to hold on to some stable identity, some stable job, some stable worldview, you will be left behind, and the world will fly by you. So people will need to be extremely resilient and emotionally balanced to sail through this never-ending storm, and to deal with very high levels of stress. The problem is that it is very hard to teach emotional intelligence and resilience. It is not something you can learn by reading a book or listening to a lecture. The current educational model, devised during the 19th century Industrial Revolution, is bankrupt. But so far we haven’t created a viable alternative. So don’t trust the adults too much. In the past, it was a safe bet to trust adults, because they knew the world quite well, and the world changed slowly. But the 21st century is going to be different. Whatever the adults have learned about economics, politics, or relationships may be outdated. Similarly, don’t trust technology too much. You must make technology serve you, instead of you serving it. If you aren’t careful, technology will start dictating your aims and enslaving you to its agenda. So you have no choice but to really get to know yourself better. Know who you are and what you really want from life. This is, of course, the oldest advice in the book: know thyself. But this advice has never been more urgent than in the 21st century. Because now you have competition. Google, Facebook, Amazon, and the government are all relying on big data and machine learning to get to know you better and better. We are not living in the era of hacking computers—we are living in the era of hacking humans. Once the corporations and governments know you better than you know yourself, they could control and manipulate you and you won’t even realize it. So if you want to stay in the game, you have to run faster than Google. Good luck! ~ Timothy Ferriss,
382:Did the Führer take her (mother) away?”
The question surprised them both, and it forced Papa to stand up. He looked at
the brown-shirted men taking to the pile of ash with shovels. He could hear them
hacking into it. Another lie was growing in his mouth, but he found it impossible
to let it out. He said, “I think he might have, yes.”
“I knew it.” The words were thrown at the steps and Liesel could feel the
slush of anger, stirring hotly in her stomach. “I hate the Führer,” she said. “I hate
him.”
And Hans Hubermann?
What did he do?
What did he say?
Did he bend down and embrace his foster daughter, as he wanted to? Did he
tell her that he was sorry for what was happening to her, to her mother, for what
had happened to her brother?
Not exactly.
He clenched his eyes. Then opened them. He slapped Liesel Meminger
squarely in the face.
“Don’t ever say that!” His voice was quiet, but sharp.
As the girl shook and sagged on the steps, he sat next to her and held his face
in his hands. It would be easy to say that he was just a tall man sitting poorpostured
and shattered on some church steps, but he wasn’t. At the time, Liesel
had no idea that her foster father, Hans Hubermann, was contemplating one of
the most dangerous dilemmas a German citizen could face. Not only that, he’d
been facing it for close to a year.
“Papa?”
The surprise in her voice rushed her, but it also rendered her useless. She
wanted to run, but she couldn’t. She could take a Watschen from nuns and Rosas,
but it hurt so much more from Papa. The hands were gone from Papa’s face now
and he found the resolve to speak again.
“You can say that in our house,” he said, looking gravely at Liesel’s cheek.
“But you never say it on the street, at school, at the BDM, never!” He stood in
front of her and lifted her by the triceps. He shook her. “Do you hear me?”
With her eyes trapped wide open, Liesel nodded her compliance.
It was, in fact, a rehearsal for a future lecture, when all of Hans Hubermann’s
worst fears arrived on Himmel Street later that year, in the early hours of a
November morning.
“Good.” He placed her back down. “Now, let us try …” At the bottom of the
steps, Papa stood erect and cocked his arm. Forty-five degrees. “Heil Hitler.”
Liesel stood up and also raised her arm. With absolute misery, she repeated it.
“Heil Hitler.” It was quite a sight—an eleven-year-old girl, trying not to cry on
the church steps, saluting the Führer as the voices over Papa’s shoulder chopped
and beat at the dark shape in the background. ~ Markus Zusak,
383:Marc Goodman is a cyber crime specialist with an impressive résumé. He has worked with the Los Angeles Police Department, Interpol, NATO, and the State Department. He is the chief cyber criminologist at the Cybercrime Research Institute, founder of the Future Crime Institute, and now head of the policy, law, and ethics track at SU. When breaking down this threat, Goodman sees four main categories of concern. The first issue is personal. “In many nations,” he says, “humanity is fully dependent on the Internet. Attacks against banks could destroy all records. Someone’s life savings could vanish in an instant. Hacking into hospitals could cost hundreds of lives if blood types were changed. And there are already 60,000 implantable medical devices connected to the Internet. As the integration of biology and information technology proceeds, pacemakers, cochlear implants, diabetic pumps, and so on, will all become the target of cyber attacks.” Equally alarming are threats against physical infrastructures that are now hooked up to the net and vulnerable to hackers (as was recently demonstrated with Iran’s Stuxnet incident), among them bridges, tunnels, air traffic control, and energy pipelines. We are heavily dependent on these systems, but Goodman feels that the technology being employed to manage them is no longer up to date, and the entire network is riddled with security threats. Robots are the next issue. In the not-too-distant future, these machines will be both commonplace and connected to the Internet. They will have superior strength and speed and may even be armed (as is the case with today’s military robots). But their Internet connection makes them vulnerable to attack, and very few security procedures have been implemented to prevent such incidents. Goodman’s last area of concern is that technology is constantly coming between us and reality. “We believe what the computer tells us,” says Goodman. “We read our email through computer screens; we speak to friends and family on Facebook; doctors administer medicines based upon what a computer tells them the medical lab results are; traffic tickets are issued based upon what cameras tell us a license plate says; we pay for items at stores based upon a total provided by a computer; we elect governments as a result of electronic voting systems. But the problem with all this intermediated life is that it can be spoofed. It’s really easy to falsify what is seen on our computer screens. The more we disconnect from the physical and drive toward the digital, the more we lose the ability to tell the real from the fake. Ultimately, bad actors (whether criminals, terrorists, or rogue governments) will have the ability to exploit this trust. ~ Peter H Diamandis,
384: Forever
Forever some customer happy to sing along with the supermarket muzak, no
matter how hackneyed or crass.
Forever the plangent sound of a motorcycle in the early hours, conjuring a world
you once had access to.
Forever the young couple shutting the front door, leaving to conjecture what
their next move may be.
Forever the van driver slowing down to check a house number against a delivery
invoice.
Forever an old boy on a rickety bike with a loyal following of one terrier-type
mongrel.
Forever the husband skulking outside the boutique while his wife seeks approval
from a mirror.
Forever the kind who believe in God (a little) and horoscopes (a lot) and cannot
resist a buy-one-get-one offer.
Forever those with a lump in the throat at every reconciliation scene, the theme
music’s pathos never failing to work its way straight to the left atrium of the
heart.
Forever the cleaning woman tapping the pub window with a coin and the
helmeted courier leaning his gob to the intercom.
Forever a caller so long on hold she wonders should she redial and brave the
bossy touch-tone menu again.
Forever a youngster hacking the grass with bat or stick in what serves as a green
space near the housing estate.
Forever, stopped in her tracks at One Hour Photo, a student smiling indulgently
at her recent past.
Forever the secretary sprinting with franked mail to the post office, minutes
before the closing curtain of steel shutters falls.
Forever, from an adjacent window, the commentator’s animated voice as the ball
approaches the goal area and lands I don’t believe it ... barely wide.
Forever the widower turning up a Viennese polka on the Sunday morning
programme and scribbling Slovak Radio Symphony Orchestra on a phone bill.
Forever the girl upending the nearly-empty crisp packet and savouring life to the
full, to the last salty cheese-and-onion flavoured crumb.
Forever the old ladies who smile at babies like politicians and suspect the meter
reader may not really be the meter reader.
Forever a freckled builder in high-vis jacket swinging his lunch-bag as he clocks
in at the chipboard hoarding.
Forever the teenagers who can’t pass up a hat display without trying on
preposterous headgear in a department store.
Forever the tall schoolboy with pony tail and full-length leather coat. And forever
the small one, pate shaved almost bald, nursing a cigarette like a sore finger.
Forever the sort who texts a request for her boyfriend to the lunchtime show then throws in a greeting to her aunt and uncle, just for the heck.
Forever the thickset woman, dragging a shopping trolley, who pauses to rub a
lottery scratch card like Aladdin’s lamp.
Forever the exasperated mother - hatchback open, hazards flashing, eyes peeled
for the traffic police - while her son, packing the drum kit, plays it cool.
Forever the laughter fading, a dropped coin spinning to a wobbly stop.
Forever life heading about its business in places vaguely familiar like an exweatherwoman’s face, a New Zealand premier’s name.
Forever. And ever. All going well.
~ Dennis O'Driscoll,
385: From La Pucelle: The Epic Of Joan Of Arc
––Listen my Prince. This is important. I could feel
the dew setting on the leaves and petals of lilies and camellias.
I was aware of the soil’s moisture being
absorbed by the roots of hollies and cedars. I could smell
the aroma of blooming jasmine and carnations. I could
taste the sweetness of wild berries and apples that hadn’t
ripened yet. My finger could already stroke the creeping
ivy that had not yet covered the oaks. And the immense moon
the heart of the vast mother nature, vitality
desire filling the universe from it…by God I was
so terrified to be there, alone, a lost little girl
in the presence of such greatness, and the white circle
was getting larger, expanding, devouring me
I was drowning in the heavenly brightness. What was
happening to me? The moon was now the shape
of an infinitely huge person’s face. No, don’t look at me
like that! By God I’m not lying. I saw this
huge face before me, a ghost, or a fairy, or a monster
whose eyes were a hundred stars, whose smile
the entire horizon, and I was on my knees by now
shivering, about to faint. I was screaming. Brightness
above the thing’s head, I couldn’t tell horns or
***
halo, glistening. Had a gigantic sword. And I
closed my eyes. I can’t believe how horrified I was. I thought
23
this thing, a demon, would kill me with its sword
but when I closed my eyes I saw, my Prince, I tell you
the truth: I saw houses burning, cities burning, countries
burning I saw hundreds of hundreds of soldiers of an unholy
empire destroying me, destroying the village, and
the whole world. I can’t remember if I saw anything more
that night before I collapsed after the first visitation
by Catherine of Alexandria herself, Matron Saint of Maidens.
II
––Well, no, I’m not mad. That’s what Mama thought
after one of my brothers found me passed out. She
became so angry. And vicious. When she found out
I hadn’t been to the stupid ceremony at the Hermitage
she lost her mind. She first broke a wooden ladle
on my back, then started whacking me with a broom
screaming: Jeannette, useless girl. Sick girl.
Shameful girl. After all I’ve done for you. Of course
I didn’t tell her what exactly I’d seen in the woods.
She would’ve said I was possessed by the Devil. I cried
for so many days, weeks, because now beautiful
Marguerite, all my friends, had been confirmed
as young women, started going to the village dances
without their parents, and they never took me. I don’t
know why I was all of a sudden so hated by everyone
and I kept getting so, so many pimples . . . no, I won’t
***
bore you with that my Prince. But you need to know
that I started going to the church frequently, and
24
started praying to the statue of Saint Catherine. I took
flowers, bread and wool to the alter, fasted every Friday
and said Pater Noster, Ave Maria and Credo in Mass
every Sunday. I confessed to our priest every week, then
every day. I spoke to Saint Catherine when there was
no one in the church. I knelt on the altar floor in the weak,
shimmering light of the votive candles and begged Her
to guide me. I wanted Mama to love me again. I wanted
Marguerite to stop flirting with idiot boys and ask me
over to her house to spin wool. And the serene statue
of Saint Catherine remained silent and looked on
as I cried. I tried to imagine what it’d be like if Her spirit
could hear me. I didn’t know I had just been visited by
the noble Saint. I was so sad, my Prince, so lonely
~ Ali Alizadeh,
386:So which theory did Lagos believe in? The
relativist or the universalist?"
"He did not seem to think there was much of a difference. In the end, they are
both somewhat mystical. Lagos believed that both schools of thought had
essentially arrived at the same place by different lines of reasoning."
"But it seems to me there is a key difference," Hiro says. "The universalists
think that we are determined by the prepatterned structure of our brains -- the
pathways in the cortex. The relativists don't believe that we have any limits."
"Lagos modified the strict Chomskyan theory by supposing that learning a
language is like blowing code into PROMs -- an analogy that I cannot interpret."
"The analogy is clear. PROMs are Programmable Read-Only Memory chips," Hiro
says. "When they come from the factory, they have no content. Once and only
once, you can place information into those chips and then freeze it -- the
information, the software, becomes frozen into the chip -- it transmutes into
hardware. After you have blown the code into the PROMs, you can read it out,
but you can't write to them anymore. So Lagos was trying to say that the
newborn human brain has no structure -- as the relativists would have it -- and
that as the child learns a language, the developing brain structures itself
accordingly, the language gets 'blown into the hardware and becomes a permanent
part of the brain's deep structure -- as the universalists would have it."
"Yes. This was his interpretation."
"Okay. So when he talked about Enki being a real person with magical powers,
what he meant was that Enki somehow understood the connection between language
and the brain, knew how to manipulate it. The same way that a hacker, knowing
the secrets of a computer system, can write code to control it -- digital namshubs?"
"Lagos said that Enki had the ability to ascend into the universe of language
and see it before his eyes. Much as humans go into the Metaverse. That gave
him power to create nam-shubs. And nam-shubs had the power to alter the
functioning of the brain and of the body."
"Why isn't anyone doing this kind of thing nowadays? Why aren't there any namshubs
in English?"
"Not all languages are the same, as Steiner points out. Some languages are
better at metaphor than others. Hebrew, Aramaic, Greek, and Chinese lend
themselves to word play and have achieved a lasting grip on reality: Palestine
had Qiryat Sefer, the 'City of the Letter,' and Syria had Byblos, the 'Town of
the Book.' By contrast other civilizations seem 'speechless' or at least, as may
have been the case in Egypt, not entirely cognizant of the creative and
transformational powers of language. Lagos believed that Sumerian was an
extraordinarily powerful language -- at least it was in Sumer five thousand
years ago."
"A language that lent itself to Enki's neurolinguistic hacking."
"Early linguists, as well as the Kabbalists, believed in a fictional language
called the tongue of Eden, the language of Adam. It enabled all men to
understand each other, to communicate without misunderstanding. It was the
language of the Logos, the moment when God created the world by speaking a word.
In the tongue of Eden, naming a thing was the same as creating it. To quote
Steiner again, 'Our speech interposes itself between apprehension and truth like
a dusty pane or warped mirror. The tongue of Eden was like a flawless glass; a
light of total understanding streamed through it. Thus Babel was a second
Fall.' And Isaac the Blind, an early Kabbalist, said that, to quote Gershom
Scholem's translation, 'The speech of men is connected with divine speech and
all language whether heavenly or human derives from one source: the Divine
Name.' The practical Kabbalists, the sorcerers, bore the title Ba'al Shem,
meaning 'master of the divine name.'"
"The machine language of the world," Hiro says. ~ Neal Stephenson,
387: Pilate's Wife's Dream
I've quenched my lamp, I struck it in that start
Which every limb convulsed, I heard it fall­
The crash blent with my sleep, I saw depart
Its light, even as I woke, on yonder wall;
Over against my bed, there shone a gleam
Strange, faint, and mingling also with my dream.
It sunk, and I am wrapt in utter gloom;
How far is night advanced, and when will day
Retinge the dusk and livid air with bloom,
And fill this void with warm, creative ray ?
Would I could sleep again till, clear and red,
Morning shall on the mountain-tops be spread!
I'd call my women, but to break their sleep,
Because my own is broken, were unjust;
They've wrought all day, and well-earned slumbers steep
Their labours in forgetfulness, I trust;
Let me my feverish watch with patience bear,
Thankful that none with me its sufferings share.
Yet, Oh, for light ! one ray would tranquilise
My nerves, my pulses, more than effort can;
I'll draw my curtain and consult the skies:
These trembling stars at dead of night look wan,
Wild, restless, strange, yet cannot be more drear
Than this my couch, shared by a nameless fear.
All black­one great cloud, drawn from east to west,
Conceals the heavens, but there are lights below;
Torches burn in Jerusalem, and cast
On yonder stony mount a lurid glow.
I see men stationed there, and gleaming spears;
A sound, too, from afar, invades my ears.
Dull, measured, strokes of axe and hammer ring
From street to street, not loud, but through the night
Distinctly heard­and some strange spectral thing
45
Is now upreared­and, fixed against the light
Of the pale lamps; defined upon that sky,
It stands up like a column, straight and high.
I see it all­I know the dusky sign­
A cross on Calvary, which Jews uprear
While Romans watch; and when the dawn shall shine
Pilate, to judge the victim will appear,
Pass sentence­yield him up to crucify;
And on that cross the spotless Christ must die.
Dreams, then, are true­for thus my vision ran;
Surely some oracle has been with me,
The gods have chosen me to reveal their plan,
To warn an unjust judge of destiny:
I, slumbering, heard and saw; awake I know,
Christ's coming death, and Pilate's life of woe.
I do not weep for Pilate­who could prove
Regret for him whose cold and crushing sway
No prayer can soften, no appeal can move;
Who tramples hearts as others trample clay,
Yet with a faltering, an uncertain tread,
That might stir up reprisal in the dead.
Forced to sit by his side and see his deeds;
Forced to behold that visage, hour by hour,
In whose gaunt lines, the abhorrent gazer reads
A triple lust of gold, and blood, and power;
A soul whom motives, fierce, yet abject, urge
Rome's servile slave, and Judah's tyrant scourge.
How can I love, or mourn, or pity him ?
I, who so long my fettered hands have wrung;
I, who for grief have wept my eye-sight dim;
Because, while life for me was bright and young,
He robbed my youth­he quenched my life's fair ray­
He crushed my mind, and did my freedom slay.
46
And at this hour­although I be his wife­
He has no more of tenderness from me
Than any other wretch of guilty life;
Less, for I know his household privacy­
I see him as he is­without a screen;
And, by the gods, my soul abhors his mien !
Has he not sought my presence, dyed in blood­
Innocent, righteous blood, shed shamelessly ?
And have I not his red salute withstood ?
Aye,­when, as erst, he plunged all Galilee
In dark bereavement­in affliction sore,
Mingling their very offerings with their gore.
Then came he­in his eyes a serpent-smile,
Upon his lips some false, endearing word,
And, through the streets of Salem, clanged the while,
His slaughtering, hacking, sacrilegious sword­
And I, to see a man cause men such woe,
Trembled with ire­I did not fear to show.
And now, the envious Jewish priests have brought
Jesus­whom they in mockery call their king­
To have, by this grim power, their vengeance wrought;
By this mean reptile, innocence to sting.
Oh ! could I but the purposed doom avert,
And shield the blameless head from cruel hurt!
Accessible is Pilate's heart to fear,
Omens will shake his soul, like autumn leaf;
Could he this night's appalling vision hear,
This just man's bonds were loosed, his life were safe,
Unless that bitter priesthood should prevail,
And make even terror to their malice quail.
Yet if I tell the dream­but let me pause.
What dream ? Erewhile the characters were clear,
Graved on my brain­at once some unknown cause
Has dimmed and rased the thoughts, which now appear,
Like a vague remnant of some by-past scene;­
Not what will be, but what, long since, has been.
47
I suffered many things, I heard foretold
A dreadful doom for Pilate,­lingering woes,
In far, barbarian climes, where mountains cold
Built up a solitude of trackless snows,
There, he and grisly wolves prowled side by side,
There he lived famished­there methought he died;
But not of hunger, nor by malady;
I saw the snow around him, stained with gore;
I said I had no tears for such as he,
And, lo ! my cheek is wet­mine eyes run o'er;
I weep for mortal suffering, mortal guilt,
I weep the impious deed­the blood self-spilt.
More I recall not, yet the vision spread
Into a world remote, an age to come­
And still the illumined name of Jesus shed
A light, a clearness, through the enfolding gloom­
And still I saw that sign, which now I see,
That cross on yonder brow of Calvary.
What is this Hebrew Christ ? To me unknown,
His lineage­doctrine­mission­yet how clear,
Is God-like goodness, in his actions shewn !
How straight and stainless is his life's career !
The ray of Deity that rests on him,
In my eyes makes Olympian glory dim.
The world advances, Greek, or Roman rite
Suffices not the inquiring mind to stay;
The searching soul demands a purer light
To guide it on its upward, onward way;
Ashamed of sculptured gods­Religion turns
To where the unseen Jehovah's altar burns.
Our faith is rotten­all our rites defiled,
Our temples sullied, and methinks, this man,
With his new ordinance, so wise and mild,
Is come, even as he says, the chaff to fan
48
And sever from the wheat; but will his faith
Survive the terrors of to-morrow's death ?
*****
I feel a firmer trust­a higher hope
Rise in my soul­it dawns with dawning day;
Lo ! on the Temple's roof­on Moriah's slope
Appears at length that clear, and crimson ray,
Which I so wished for when shut in by night;
Oh, opening skies, I hail, I bless your light !
Part, clouds and shadows ! glorious Sun appear !
Part, mental gloom ! Come insight from on high !
Dusk dawn in heaven still strives with daylight clear,
The longing soul, doth still uncertain sigh.
Oh ! to behold the truth­that sun divine,
How doth my bosom pant, my spirit pine !
This day, time travails with a mighty birth,
This day, Truth stoops from heaven and visits earth,
Ere night descends, I shall more surely know
What guide to follow, in what path to go;
I wait in hope­I wait in solemn fear,
The oracle of God­the sole­true God­to hear.
~ Charlotte Brontë,
388: The Four Brothers
MAKE war songs out of these;
Make chants that repeat and weave.
Make rhythms up to the ragtime chatter of the machine guns;
Make slow-booming psalms up to the boom of the big guns.
Make a marching song of swinging arms and swinging legs,
Going along,
Going along,
On the roads from San Antonio to Athens, from Seattle to BagdadThe boys and men in winding lines of khaki, the circling squares of bayonet
points.
Cowpunchers, cornhuskers, shopmen, ready in khaki;
Ballplayers, lumberjacks, ironworkers, ready in khaki;
A million, ten million, singing, 'I am ready.'
This the sun looks on between two seaboards,
In the land of Lincoln, in the land of Grant and Lee.
I heard one say, 'I am ready to be killed.'
I heard another say, 'I am ready to be killed.'
O sunburned clear-eyed boys!
I stand on sidewalks and you go by with drums and guns and bugles,
You-and the flag!
And my heart tightens, a fist of something feels my throat
When you go by,
You on the kaiser hunt, you and your faces saying, 'I am ready to be killed.'
They are hunting death,
Death for the one-armed mastoid kaiser.
They are after a Hohenzollern head:
There is no man-hunt of men remembered like this.
The four big brothers are out to kill.
France, Russia, Britain, AmericaThe four republics are sworn brothers to kill the kaiser.
Yes, this is the great man-hunt;
And the sun has never seen till now
Such a line of toothed and tusked man-killers,
In the blue of the upper sky,
415
In the green of the undersea,
In the red of winter dawns.
Eating to kill,
Sleeping to kill,
Asked by their mothers to kill,
Wished by four-fifths of the world to killTo cut the kaiser's throat,
To hack the kaiser's head,
To hang the kaiser on a high-horizon gibbet.
And is it nothing else than this?
Three times ten million men thirsting the blood
Of a half-cracked one-armed child of the German kings?
Three times ten million men asking the blood
Of a child born with his head wrong-shaped,
The blood of rotted kings in his veins?
If this were all, O God,
I would go to the far timbers
And look on the gray wolves
Tearing the throats of moose:
I would ask a wilder drunk of blood.
Look! It is four brothers in joined hands together.
The people of bleeding France,
The people of bleeding Russia,
The people of Britain, the people of AmericaThese are the four brothers, these are the four republics.
At first I said it in anger as one who clenches his fist in wrath to fling his knuckles
into the face of some one taunting;
Now I say it calmly as one who has thought it over and over again at night,
among the mountains, by the seacombers in storm.
I say now, by God, only fighters to-day will save the world, nothing but fighters
will keep alive the names of those who left red prints of bleeding feet at Valley
Forge in Christmas snow.
On the cross of Jesus, the sword of Napoleon, the skull of Shakespeare, the pen
of Tom Jefferson, the ashes of Abraham Lincoln, or any sign of the red and
running life poured out by the mothers of the world,
By the God of morning glories climbing blue the doors of quiet homes, by the
God of tall hollyhocks laughing glad to children in peaceful valleys, by the God of
new mothers wishing peace to sit at windows nursing babies,
I swear only reckless men, ready to throw away their lives by hunger,
416
deprivation, desperate clinging to a single purpose imperturbable and undaunted,
men with the primitive guts of rebellion,
Only fighters gaunt with the red brand of labor's sorrow on their brows and
labor's terrible pride in their blood, men with souls asking danger-only these will
save and keep the four big brothers.
Good-night is the word, good-night to the kings, to the czars,
Good-night to the kaiser.
The breakdown and the fade-away begins.
The shadow of a great broom, ready to sweep out the trash, is here.
One finger is raised that counts the czar,
The ghost who beckoned men who come no moreThe czar gone to the winds on God's great dustpan,
The czar a pinch of nothing,
The last of the gibbering Romanoffs.
Out and good-nightThe ghosts of the summer palaces
And the ghosts of the winter palaces!
Out and out, good-night to the kings, the czars, the kaisers.
Another finger will speak,
And the kaiser, the ghost who gestures a hundred million sleeping-waking
ghosts,
The kaiser will go onto God's great dustpanThe last of the gibbering Hohenzollerns.
Look! God pities this trash, God waits with a broom and a dustpan,
God knows a finger will speak and count them out.
It is written in the stars;
It is spoken on the walls;
It clicks in the fire-white zigzag of the Atlantic wireless;
It mutters in the bastions of thousand-mile continents;
It sings in a whistle on the midnight winds from Walla Walla to Mesopotamia:
Out and good-night.
The millions slow in khaki,
The millions learning Turkey in the Straw and John Brown's Body,
The millions remembering windrows of dead at Gettysburg, Chickamauga, and
Spottsylvania Court House,
The millions dreaming of the morning star of Appomattox,
417
The millions easy and calm with guns and steel, planes and prows:
There is a hammering, drumming hell to come.
The killing gangs are on the way.
God takes one year for a job.
God takes ten years or a million.
God knows when a doom is written.
God knows this job will be done and the words spoken:
Out and good-night.
The red tubes will run,
And the great price be paid,
And the homes empty,
And the wives wishing,
And the mothers wishing.
There is only one way now, only the way of the red tubes and the great price.
Well...
Maybe the morning sun is a five-cent yellow balloon,
And the evening stars the joke of a God gone crazy.
Maybe the mothers of the world,
And the life that pours from their torsal foldsMaybe it's all a lie sworn by liars,
And a God with a cackling laughter says:
'I, the Almighty God,
I have made all this,
I have made it for kaisers, czars, and kings.'
Three times ten million men say: No.
Three times ten million men say:
God is a God of the People.
And the God who made the world
And fixed the morning sun,
And flung the evening stars,
And shaped the baby hands of life,
This is the God of the Four Brothers;
This is the God of bleeding France and bleeding Russia;
This is the God of the people of Britain and America.
The graves from the Irish Sea to the Caucasus peaks are ten times a million.
The stubs and stumps of arms and legs, the eyesockets empty, the cripples, ten
times a million.
418
The crimson thumb-print of this anathema is on the door panels of a hundred
million homes.
Cows gone, mothers on sick-beds, children cry a hunger and no milk comes in
the noon-time or at night.
The death-yells of it all, the torn throats of men in ditches calling for water, the
shadows and the hacking lungs in dugouts, the steel paws that clutch and
squeeze a scarlet drain day by day-the storm of it is hell.
But look! child! the storm is blowing for a clean air.
Look! the four brothers march
And hurl their big shoulders
And swear the job shall be done.
Out of the wild finger-writing north and south, east and west, over the bloodcrossed, blood-dusty ball of earth,
Out of it all a God who knows is sweeping clean,
Out of it all a God who sees and pierces through, is breaking and cleaning out an
old thousand years, is making ready for a new thousand years.
The four brothers shall be five and more.
Under the chimneys of the winter time the children of the world shall sing new
songs.
Among the rocking restless cradles the mothers of the world shall sing new
sleepy-time songs.
~ Carl Sandburg,
389: The Roll Of The Kettledrum
'You have the Pyrrhic dance as yet,
Where is the Pyrrhic phalanx gone ?
Of two such lessons, why forget
The nobler and the manlier one ?'—Byron.
ONE line of swart profiles, and bearded lips dressing,
One ridge of bright helmets, one crest of fair plumes,
One streak of blue sword-blades all bared for the fleshing,
One row of red nostrils that scent battle-fumes.
Forward ! the trumpets were sounding the charge,
The roll of the kettledrum rapidly ran,
That music, like wild-fire spreading at large,
Madden'd the war-horse as well as the man.
Forward ! still forward ! we thunder'd along,
Steadily yet, for our strength we were nursing ;
Tall Ewart, our sergeant, was humming a song,
Lance-corporal Black Will was blaspheming and cursing.
Open'd their volley of guns on our right,
Puffs of grey smoke, veiling gleams of red flame,
Curling to leeward, were seen on the height,
Where the batteries were posted, as onward we came.
Spreading before us their cavalry lay,
Squadron on squadron, troop upon troop ;
We were so few, and so many were they—
Eagles wait calmly the sparrow-hawk's stoop.
Forward ! still forward ! steed answering steed
Cheerily neigh'd, while the foam flakes were toss'd
From bridle to bridle—the top of our speed
Was gain'd, but the pride of our order was lost.
One was there, leading by nearly a rood,
Though we were racing he kept to the fore,
Still as a rock in his stirrups he stood,
High in the sunlight his sabre he bore.
275
Suddenly tottering, backwards he crash'd,
Loudly his helm right in front of us rung ;
Iron hoofs thunder'd, and naked steel flash'd
Over him—youngest, where many were young.
Now we were close to them, every horse striding
Madly ;—St. Luce pass'd with never a groan ;—
Sadly my master look'd round—he was riding
On the boy's right, with a line of his own.
Thrusting his hand in his breast or breast pocket,
While from his wrist the sword swung by a chain,
Swiftly he drew out some trinket or locket,
Kiss'd it (I think) and replaced it again.
Burst, while his fingers reclosed on the haft,
Jarring concussion and earth shaking din,
Horse 'counter'd horse, and I reel'd, but he laugh'd,
Down went his man, cloven clean to the chin !
Wedged in the midst of that struggling mass,
After the first shock, where each his foe singled,
Little was seen save a dazzle, like glass
In the sun, with grey smoke and black dust intermingled.
Here and there redden'd a pistol shot, flashing
Through the red sparkle of steel upon steel !
Redder the spark seem'd, and louder the clashing,
Struck from the helm by the iron-shod heel !
Over fallen riders, like wither'd leaves strewing
Uplands in autumn, we sunder'd their ranks ;
Steeds rearing and plunging, men hacking and hewing,
Fierce grinding of sword-blades, sharp goading of flanks.
Short was the crisis of conflict soon over,
Being too good (I suppose) to last long ;
Through them we cut, as the scythe cuts the clover,
Batter'd and stain'd we emerged from their throng.
Some of our saddles were emptied, of course ;
276
To heaven (or elsewhere) Black Will had been carried !
Ned Sullivan mounted Will's riderless horse,
His mare being hurt, while ten seconds we tarried.
And then we re-formed, and went at them once more,
And ere they had rightly closed up the old track,
We broke through the lane we had open'd before,
And as we went forward e'en so we came back.
Our numbers were few, and our loss far from small,
They could fight, and, besides, they were twenty to one ;
We were clear of them all when we heard the recall,
And thus we returned, but my tale is not done.
For the hand of my rider felt strange on my bit,
He breathed once or twice like one partially choked,
And sway'd in his seat, then I knew he was hit :—
He must have bled fast, for my withers were soak'd,
And scarcely an inch of my housing was dry ;
I slacken'd my speed, yet I never quite stopp'd,
Ere he patted my neck, said, 'Old fellow, good-bye !'
And dropp'd off me gently, and lay where he dropp'd !
Ah, me ! after all, they may call us dumb creatures—
I tried hard to neigh, but the sobs took my breath,
Yet I guess'd, gazing down at those still, quiet features,
He was never more happy in life than in death.
.................
Two years back, at Aldershot, Elrington mentioned
My name to our colonel one field-day. He said,
' 'Count,' 'Steeltrap,' and 'Challenger' ought to be pension'd ;'
'Count' died the same week, and now 'Steeltrap' is dead.
That morning our colonel was riding 'Theresa,'
The filly by 'Teddington' out of 'Mistake' ;
His girls, pretty Alice and fair-haired Louisa,
Were there on the ponies he purchased from Blake.
I remember he pointed me out to his daughters,
277
Said he, 'In this troop I may fairly take pride,
But I've none left like him in my officers' quarters,
Whose life-blood the mane of old 'Challenger' dyed.'
Where are they ? the war-steeds who shared in our glory,
The 'Lanercost' colt, and the 'Acrobat' mare,
And the Irish division, 'Kate Kearney' and 'Rory,'
And rushing 'Roscommon,' and eager 'Kildare,'
And
And
And
And
'Freeny,' a favourite once with my master,
'Warlock,' a sluggard, but honest and true,
'Tancred,' as honest as 'Warlock,' but faster,
'Blacklock,' and 'Birdlime,' and 'Molly Carew' ?—
All vanish'd, what wonder ! twelve summers have pass'd
Since then, and my comrade lies buried this day,—
Old 'Steeltrap,' the kicker,—and now I'm the last
Of the chargers who shared in that glorious fray.
.................
Come, 'Harlequin,' keep your nose out of my manger,
You'll get your allowance, my boy, and no more ;
Snort ! 'Silvertail,' snort ! when you've seen as much danger
As I have, you won't mind the rats in the straw.
.................
Our gallant old colonel came limping and halting,
The day before yesterday, into my stall ;
Oh ! light to the saddle I've once seen him vaulting,
In full marching order, steel broadsword and all.
And now his left leg than his right is made shorter
Three inches, he stoops, and his chest is unsound ;
He spoke to me gently, and patted my quarter,
I laid my ears back and look'd playfully round.
For that word kindly meant, that caress kindly given,
I thank'd him, though dumb, but my cheerfulness fled ;
More sadness I drew from the face of the living
Than years back I did from the face of the dead.
278
For the dead face, upturn'd, tranquil, joyous, and fearless,
Look'd straight from green sod to blue fathomless sky
With a smile ; but the living face, gloomy and tearless,
And haggard and harass'd, look'd down with a sigh.
Did he think on the first time he kiss'd Lady Mary ?
On the morning he wing'd Horace Greville the beau ?
On the winner he steer'd in the grand military ?
On the charge that he headed twelve long years ago ?
Did he think on each fresh year, of fresh grief the herald ?
On lids that are sunken, and locks that are grey ?
On Alice, who bolted with Brian Fitzgerald ?
On Rupert, his first-born, dishonour'd by 'play' ?
On Louey, his darling, who sleeps 'neath the cypress,
That shades her and one whose last breath gave her life ?
I saw those strong fingers hard over each eye press—
Oh ! the dead rest in peace when the quick toil in strife !
.................
Scoff, man ! egotistical, proud, unobservant,
Since I with man's grief dare to sympathize thus ;
Why scoff ?—fellow-creature I am, fellow-servant
Of God, can man fathom God's dealings with us ?
The wide gulf that parts us may yet be no wider
Than that which parts you from some being more blest ;
And there may be more links 'twixt the horse and his rider
Than ever your shallow philosophy guess'd.
You are proud of your power, and vain of your courage,
And your blood, Anglo-Saxon, or Norman, or Celt ;
Though your gifts you extol, and our gifts you disparage,
Your perils, your pleasures, your sorrows we've felt.
We, too, sprung from mares of the prophet of Mecca,
And nursed on the pride that was born with the milk,
And filtered through 'Crucifix,' 'Beeswing,' 'Rebecca,'
We love sheen of scarlet and shimmer of silk.
279
We, too, sprung from loins of the Ishmaelite stallions,
We glory in daring that dies or prevails ;
From 'counter of squadrons, and crash of battalions,
To rending of blackthorns, and rattle of rails.
In all strife where courage is tested, and power,
From the meet on the hill-side, the horn-blast, the find,
The burst, the long gallop that seems to devour
The champaign, all obstacles flinging behind,
To the cheer and the clarion, the war-music blended
With war-cry, the furious dash at the foe,
The terrible shock, the recoil, and the splendid
Bare sword, flashing blue rising red from the blow.
I've borne one through perils where many have seen us,
No tyrant, a kind friend, a patient instructor,
And I've felt some strange element flashing between us,
Till the saddle seem'd turn'd to a lightning conductor.
Did he see ? could he feel through the faintness, the numbness,
While linger'd the spirit half-loosed from the clay,
Dumb eyes seeking his in their piteous dumbness,
Dumb quivering nostrils, too stricken to neigh ?
And what then ? the colours reversed, the drums muffled,
The black nodding plumes, the dead march, and the pall,
The stern faces, soldier-like, silent, unruffled,
The slow sacred music that floats over all !
Cross carbine and boar-spear, hang bugle and banner,
Spur, sabre, and snaffle, and helm—Is it well ?
Vain 'scutcheon, false trophies of Mars and Diana,—
Can the dead laurel sprout with the live immortelle ?
It may be,—we follow, and though we inherit
Our strength for a season, our pride for a span,
Say ! vanity are they ? vexation of spirit ?
Not so, since they serve for a time horse and man.
They serve for a time, and they make life worth living,
280
In spite of life's troubles—'tis vain to despond ;
Oh, man ! we at least, we enjoy, with thanksgiving,
God's gifts on this earth, though we look not beyond.
You sin, and you suffer, and we, too, find sorrow,
Perchance through your sin—yet it soon will be o'er ;
We labour to-day, and we slumber to-morrow,
Strong horse and bold rider !—and who knoweth more ?
.................
In our barrack-square shouted Drill-sergeant M'Cluskie,
The roll of the kettledrum rapidly ran,
The colonel wheel'd short, speaking once, dry and husky,
'Would to God I had died with your master, old man !'
~ Adam Lindsay Gordon,

--- IN CHAPTERS (in Dictionaries, in Quotes, in Chapters)



6

   1 Occultism






1.01_-_Economy, #Walden, and On The Duty Of Civil Disobedience, #Henry David Thoreau, #Philosophy
  Be sure that you give the poor the aid they most need, though it be your example which leaves them far behind. If you give money, spend yourself with it, and do not merely abandon it to them. We make curious mistakes sometimes. Often the poor man is not so cold and hungry as he is dirty and ragged and gross. It is partly his taste, and not merely his misfortune. If you give him money, he will perhaps buy more rags with it. I was wont to pity the clumsy Irish laborers who cut ice on the pond, in such mean and ragged clothes, while I shivered in my more tidy and somewhat more fashionable garments, till, one bitter cold day, one who had slipped into the water came to my house to warm him, and I saw him strip off three pairs of pants and two pairs of stockings ere he got down to the skin, though they were dirty and ragged enough, it is true, and that he could afford to refuse the _extra_ garments which
  I offered him, he had so many _intra_ ones. This ducking was the very thing he needed. Then I began to pity myself, and I saw that it would be a greater charity to bestow on me a flannel shirt than a whole slop-shop on him. There are a thousand Hacking at the branches of evil to one who is striking at the root, and it may be that he who bestows the largest amount of time and money on the needy is doing the most by his mode of life to produce that misery which he strives in vain to relieve. It is the pious slave-breeder devoting the proceeds of every tenth slave to buy a Sundays liberty for the rest. Some show their kindness to the poor by employing them in their kitchens. Would they not be kinder if they employed themselves there? You boast of spending a tenth part of your income in charity; maybe you should spend the nine tenths so, and done with it. Society recovers only a tenth part of the property then. Is this owing to the generosity of him in whose possession it is found, or to the remissness of the officers of justice?
  

2.24_-_The_Evolution_of_the_Spiritual_Man, #The Life Divine, #Sri Aurobindo, #Integral Yoga
  But as the mental and life development increased, - for that is Nature's first preoccupation in man and she does not hesitate to push it forward at the cost of other elements that will need to be taken up fully hereafter, - there is a tendency towards intellectualisation, and the first necessary intuitive, instinctive and subliminal formations are overlaid with the structures erected by a growing force of reason and mental intelligence. As man discovers the secrets and processes of physical Nature, he moves more and more away from his early recourse to occultism and magic; the presence and felt influence of gods and invisible powers recedes as more and more is explained by natural workings, the mechanical procedure of Nature: but he still feels the need of a spiritual element and spiritual factors in his life and therefore keeps for a time the two activities running together. But the occult elements of religion, though still held as beliefs or preserved but also buried in rites and myths, lose their significance and diminish and the intellectual element increases; finally, where and when the intellectualising tendency becomes too strong, there is a movement to cut out everything but creed, institution, formal practice and ethics. Even the element of spiritual experience dwindles and it is considered sufficient to rely only on faith, emotional fervour and moral conduct; the first amalgam of religion, occultism and mystic experience is disrupted, and there is a tendency, not by any means universal or complete but still pronounced or visible, for each of these powers to follow its own way to its own goal in its own separate and free character.
  A complete denial of religion, occultism and all that is supraphysical is the last outcome of this stage, a hard dry paroxysm of the superficial intellect Hacking away the sheltering structures that are refuges for the deeper parts of our nature. But still evolutionary Nature keeps alive her ulterior intentions in the minds of a few and uses man's greater mental evolution to raise them to a higher plane and deeper issues. In the present time itself, after an age of triumphant intellectuality and materialism, we can see evidences of this natural process, - a return towards inner self-discovery, an inner seeking and thinking, a new attempt at mystic experience, a groping after the inner self, a reawakening to some sense of the truth and power of the spirit begins to manifest itself; man's search after his self and soul and a deeper truth of things tends to revive and resume its lost force and to give a fresh life to the old creeds, erect new faiths or develop independently of sectarian religions. The intellect itself, having reached near to the natural limits of the capacity of physical discovery, having touched its bedrock and found that it explains nothing more than the outer process of Nature, has begun, still tentatively and hesitatingly, to direct an eye of research on the deeper secrets of the mind and the life force and on the domain of the occult which it had rejected a priori, in order to know what there may be in it that is true. Religion itself has shown its power of survival and is undergoing an evolution the final sense of which is still obscure. In this new phase of the mind that we see beginning, however crudely and hesitatingly, there can be detected the possibility of a pressure towards some decisive turn and advance of the spiritual evolution in Nature. Religion, rich but with a certain obscurity in her first infrarational stage, had tended under the overweight of the intellect to pass into a clear but bare rational interspace; but it must in the end follow the upward curve of the human mind and rise more fully at its summits towards its true or greatest field in the sphere of a suprarational consciousness and knowledge.
  If we look at the past, we can still see the evidences of this line of natural evolution, although most of its earlier stages are hidden from us in the unwritten pages of prehistory. It has been contended that religion in its beginnings was nothing but a mass of animism, fetishism, magic, totemism, taboo, myth, superstitious symbol, with the medicine-man as priest, a mental fungus of primitive human ignorance, - later on at its best a form of Nature-worship. It could well have been so in the primitive mind, though we have to add the proviso that behind much of its beliefs and practices there may have been a truth of an inferior but very effective kind that we have lost with our superior development. Primitive man lives much in a low and small province of his life-being, and this corresponds on the occult plane to an invisible Nature which is of a like character and whose occult powers can be called into activity by a knowledge and methods to which the lower vital intuitions and instincts may open a door of access. This might be formulated in a first stage of religious belief and practice which would be occult after a crude inchoate fashion in its character and interests, not yet spiritual; its main element would be a calling in of small lifepowers and elemental beings to the aid of small life-desires and a rude physical welfare.

3.08_-_Of_Equilibrium, #Liber ABA, #Aleister Crowley, #Philosophy
  [64] cut with a single stroke of the knife. There must be no boggling and
  Hacking at things, no clumsiness and no hesitation. If you strike a
  blow at all, strike with all your strength! Whatsoever thy hand

Aeneid, #unset, #Sri Aurobindo, #Integral Yoga
  "My comrades now attack in strangest struggle,
  Hacking at these lewd birds come from the sea.
  No blow can wound their wings or scar their backs.
  --
  In no time, ladders, sudden fires appear.
  Some hurry to the gateways, Hacking down
  the first guards they encounter; others cast

The_Golden_Bough, #unset, #Sri Aurobindo, #Integral Yoga
  are magicians who can make a man ill by stabbing his shadow with a
  pike or Hacking it with a sword. After Sankara had destroyed the
  Buddhists in India, it is said that he journeyed to Nepaul, where he

The_Pilgrims_Progress, #unset, #Sri Aurobindo, #Integral Yoga
  Then said Christian, May we go in thither?
  {83} Then the Interpreter took him, and led him up towards the door of the palace; and behold, at the door stood a great company of men, as desirous to go in; but durst not. There also sat a man at a little distance from the door, at a table-side, with a book and his inkhorn before him, to take the name of him that should enter therein; he saw also, that in the doorway stood many men in armour to keep it, being resolved to do the men that would enter what hurt and mischief they could. Now was Christian somewhat in amaze. At last, when every man started back for fear of the armed men, Christian saw a man of a very stout countenance come up to the man that sat there to write, saying, Set down my name, Sir: the which when he had done, he saw the man draw his sword, and put a helmet upon his head, and rush toward the door upon the armed men, who laid upon him with deadly force; but the man, not at all discouraged, fell to cutting and Hacking most fiercely. So after he had received and given many wounds to those that attempted to keep him out, he cut his way through them all [Acts 14:22], and pressed forward into the palace, at which there was a pleasant voice heard from those that were within, even of those that walked upon the top of the palace, saying--
  "Come in, come in; Eternal glory thou shalt win."

change font "color":
change "background-color":
change "font-family": 53541 site hits